NOVEL MUTATION IN THE CMV UL97 GENE ASSOCIATED WITH RESISTANCE TO GANCICLOVIR THERAPY

Cytomegalovirus (CMV) is a serious complication in immunocompromised individuals and is a major cause of morbidity and mortality ⁽¹⁾. Analysis of risk factors in solid organ transplant recipients has provided important clues for the identification of those patients at risk for developing symptomatic CMV infection ⁽²⁾. With the availability of clinically effective antiviral therapy, it has become increasingly important to determine the role of universal prophylaxis versus _targeted antiviral therapy in the group of transplant patients at risk for developing CMV disease. One concern with regard to the early and long-term use of antiviral prophylaxis in the posttransplant period focuses on the possibility of selecting for antiviral drug resistant CMV strains. Although most of the ganciclovir resistant CMV strains have been isolated from patients with acquired immune deficiency syndrome after prolonged courses of ganciclovir, other immunocompromised patients, such as transplant recipients, may be at risk for developing infection with antiviral drug resistant CMV strains ⁽³⁾. In the field of antiviral resistance, two main areas of research have focused on the study of the genetic mechanisms by which CMV develops, that is, ganciclovir resistance, and the practical problem of laboratory testing for resistant virus in a rapid, accurate, and clinically useful manner.

CMV clinical isolates resistant to GCV have been associated with impaired phosphorylation of this compound resulting from mutations in the UL97 phosphotransferase gene ^{(4, 9, 10, 11)}. Mutations at codons 460, 594, and 595 are the most frequent, and one or more of these occur in the majority of GCV-resistant CMV ^{(4, 9)}. Rapid genotypic testing for UL97 mutations could be an effective method for detecting GCV resistance in the clinical setting, but its diagnostic application has not been validated. This report describes the occurrence of a novel deletion mutation in the UL97 gene of a CMV strain from a renal transplant recipient with CMV viremia and colitis that developed after prolonged exposure to this drug in the posttransplant period for intermittent episodes of CMV disease. In addition, we demonstrate the feasibility of using molecular genetic techniques, such as the combination of PCR-based amplification and sequencing for the rapid diagnosis of ganciclovir resistant CMV strains in the clinical setting.

MATERIALS AND METHODS

Case Report. A 36-year-old CMV seronegative woman underwent renal transplantation with an organ from a CMV seropositive donor for end-stage renal disease secondary to proliferative glomerulonephritis resulting from IgA/Henoch-Schonlein's nephropathy (Fig. 1). The initial immunosuppression consisted of prednisone, mycophenolic acid, and OKT3. Ganciclovir (5 mg/kg/q.d. i.v.) was administered for the first 14 days post renal transplantation, followed by oral acyclovir (3.2 gm/p.o./q.d.). On day 78 posttransplant, the patient developed fever and malaise, and CMV viremia was documented by recovery of the virus in cell cultures. Ganciclovir (5 mg/kg/b.i.d./i.v.) was administered for 14 days. Four days after completing ganciclovir therapy, the patient was readmitted with fever and malaise; CMV viremia was again documented and ganciclovir treatment was reinitiated at 5 mg/kg/b.i.d./i.v. Despite outpatient i.v. ganciclovir therapy, on day 164 posttransplant, the patient was readmitted with fever, malaise, abdominal pain. and lower gastrointestinal bleeding. CMV colitis was documented by the detection of CMV inclusion bodies in biopsy tissue obtained from the colon by endoscopy. CMV was recovered in cell cultures from the biopsy specimens. Intravenous ganciclovir was continued at the same dose until day 261 posttransplant when serial blood specimens were negative for CMV in cell cultures; at this time, oral ganciclovir (3 gm/p.o./q.d.) was administered to the patient. On day 477 posttransplant, the patient was readmitted with fever and renal biopsy demonstrated severe acute allograft rejection for which the patient received treatment with methylprednisone and continued with azathioprine and cyclosporin. However, during this admission and despite being treated with continuous p.o. ganciclovir, the patient developed CMV viremia and the virus was also recovered in cell cultures from a renal biopsy specimen. The patient was switched from oral to i.v. ganciclovir (5 mg/kg/b.i.d.), and on day 510 posttransplant, and before completing the i.v. course of ganciclovir, she developed fever, malaise, abdominal pain, and lower gastrointestinal bleeding. Biopsy tissue from the colon yielded CMV in cell cultures. In addition, CMV was also isolated at the same time from blood and urine specimens. Over the following days, she remained symptomatic with persistent viremia despite treatment with i.v. ganciclovir. After 514 days posttransplant, the patient was treated with a 3-week course of i.v. foscarnet. The patient improved with resolution of symptoms, and CMV was not cultured in rapid or in conventional cell cultures, nor was DNA amplified by PCR from subsequent blood specimens. On days 561, 600, and 750 posttransplantation, the patient was again evaluated and remained asymptomatic and without detectable CMV by cultures or by PCR-based techniques from a blood specimen.

PCR Based Amplification and Genomic Sequencing.. Nucleic acids were extracted from PBL by the lysis method and from tissue biopsy specimens by using a universal DNA isolation technique as previously described ^{(5, 6)}. A fragment of the catalytic domain of UL97 was amplified by PCR using viral DNA from the patient's CMV isolates and primers designed on the basis of published data for strain AD169 ⁽¹²⁾. Primer sequences were 5′ GGCTGCTGTCTGCT GCACAACG 3′ (outer primer, forward), 5′ ACTCGGGGAACAGTTGGCGGCA 3′ (outer primer, reverse), 5′ GACGCTATCAAATTTCTCAA 3′ (inner primer, forward), 5′ CGTTATATAAATACAGCCCG 3′ (inner primer, reverse). PCR was performed with Taq polymerase and consisted of 40 cycles at 95°C for 1 min, 55°C for 1 min, and 72°C for 1 min. Amplified products were purified and sequenced with a commercial kit (Prism Ready Reaction Dyedeoxy Terminator Cycle sequencing kit, Applied Biosystems) and sequencing primers were 5′ GACGCTATCAAATTTCTCAA 3′ (seq A, forward), 5′ CGCCGTAGACCGGCTACGGG 3′ (seq B, reverse), 5′ CCCGTAGCC GGTCTACGGCG 3′ (seq C, forward), and 5′ CGTTATATAAATACAGCCCG 3′ (seq D, reverse). UL97 sequences were aligned by computer analysis with that of strain AD169 to determine whether polymorphisms were present in the PCR _target region. Mutant strains of CMV (V717786 and V7477923), provided by Dr. A. Erice (University of Minnesota), were analyzed in parallel as controls.

Sequence changes detected in the vicinity of UL97 codons 591-607 were rechecked by amplification and resequencing using the same methods and an independent set of primers. Outer PCR primers were CPT1088 ⁽³⁾ and CPTT (5′-AAACAGACTGAGGGGCTCATCGTC-3′), and inner primers were CPT1285 ⁽⁹⁾ and CPTR (5′-CTCAGCAACCGTCACGTTCCGCGTCCCG-3′). Sequencing was performed with CPT1471 (5′-TACAACGAGCGCTGTGTGGCCGTC-3′), CPT1650 (5′-GTCGGAGCTGTCGGCGCTGGG-3′), and CPT2096 ⁽¹⁰⁾.

RESULTS

CMV UL97 sequences were amplified from DNA extracts of a blood specimen (day 78), a colon biopsy specimen (day 164), and from the same specimen types at day 510. No CMV mutations associated with drug resistance (codons 460, 520, or 591-607) were detected from blood and colon specimens taken at days 78 and 164, respectively. In contrast, both specimens from days 510 showed the same UL97 mutation in which codons 595 through 603 were deleted.

DISCUSSION

This case illustrates the development of a novel deletion mutation in the UL97 gene of a CMV strain isolated from a solid organ recipient with CMV disease refractory to prolonged ganciclovir treatment. PCR amplification and UL97 sequence analysis enabled rapid identification of the mutation directly in clinical specimens. This diagnostic approach also bypasses a limitation introduced by the widespread use of rapid diagnostic techniques for CMV, such as shell vial culture or antigenemia assays, which do not yield a propagated viral isolate. Although no cell culture susceptibility test results are available, the observation in this case of clinical resistance to ganciclovir treatment, subsequent response to foscarnet, and the absence of the mutation in earlier posttransplant specimens, all support a role of the codon 595-603 deletion in ganciclovir resistance, as predicted from previous data.

So far, ganciclovir resistant CMV strains have mainly been recovered from patients with AIDS after prolonged therapy for retinitis ⁽⁷⁾. However, with the reduction in invasive CMV disease resulting from effective antiretroviral therapy, and the continuing use of powerful immunosuppressive agents in transplantation, there are now increasing case reports of CMV resistance in solid organ transplantation ⁽⁸⁾. Our patient showed typical risk factors for the development of resistance, including immunosuppression from multiple rounds of anti-rejection therapy, and primary CMV infection which predisposes to prolonged circulation of higher viral loads. Lack of response to ganciclovir in this setting would be an indication for CMV resistance testing, such as the genotypic assay used here. Phenotypic tests have a useful confirmation role if an isolate is available, but tend to be too slow to guide clinical practice.

UL97 mutations are sufficiently well understood to predict a role in ganciclovir resistance in most cases. In wild type isolates, the gene is well conserved ⁽⁴⁾ and altered amino acid configurations at codons 460, (V460, I460), 520 (Q520), and 591-607 (including V591, G592, V594, S595, F595, W603, Y607, and a deletion at codons 591-594, among others) have been specifically associated with impaired ganciclovir phosphorylation and ganciclovir resistance ^{(4, 9, 10, 11)}. Many of these mutations have been proved to confer resistance by transfer into laboratory CMV strains ^{(4, 10, 11)}. The deletion mutation reported here (codons 595-603) is of interest because it is the largest deletion observed so far in the codon range 591-607, and it is complementary to the other known multicodon deletion (591-594) related to resistance ⁽⁹⁾. Together, these two mutations suggest that most of the codons 591-607 are dispensable for UL97 function, even though the gene itself seems to be essential for effective CMV replication ⁽¹³⁾. Changes in this codon range probably affect recognition of ganciclovir as a substrate without impairing biological function. Although mutations at codons 460, 594, and 595 remain the most common ⁽⁹⁾, the continuing identification of unusual resistance-related mutations at codons 591-607 suggests the need for flexible genotyping methods that can identify a wide variety of changes in this region. For now, the direct sequencing of PCR products is the most informative approach, and screening methods based on hybridization to specific probes or probe arrays need to take into account complications introduced by the large deletion encountered here.