Identification of the miR-106b∼25 MicroRNA Cluster as a Proto-Oncogenic PTEN-_targeting Intron That Cooperates with Its Host Gene MCM7 in Transformation

PTEN abundance is regulated by multiple miRNA families

To identify PTEN-_targeting miRNAs, we filtered the output of four _target prediction algorithms [_targetScanS (14), PicTar (15), miRanda (16), and miRBase (17) (table S1)]. Our selection criteria considered miRNA families that (i) had oncogenic potential and (ii) were predicted to _target PTEN by multiple algorithms (see table S2 for details). The seven miRNA families that passed our dual-criteria approach are listed in Fig. 1A. The miR-193 and miR-198 families were not found to down-regulate PTEN; therefore, they were not investigated further. Two families, miR-17 and miR-19, had been previously identified as _targeting PTEN (18–21), confirming the reliability of our screen. The miR-17, miR-19, miR-22, miR-25, and miR-302 families were further characterized. The members of these families and the location of their seed matches in the PTEN 3′UTR are depicted in fig. S1A and Fig. 1C, respectively. The genomic organization indicates that different PTEN-_targeting miRNAs can be transcribed from the same multicistronic precursor (Fig. 1B).

To validate their ability to decrease PTEN abundance, we overexpressed a representative member of each of the five miRNA families as a synthetic short interfering–like molecule (si-miRNA) in the DU145 prostate cancer cell line [in which PTEN is wild type (22) and the expressed 3′UTR harbors all the predicted miRNA binding sites (fig. S1E)]. The abundance of both PTEN protein and transcript was reduced by all tested miRNAs (Fig. 2A and fig. S2). The miRNA-mediated decrease in PTEN abundance was confirmed functionally; miRNA overexpression led to increased abundance of the PTEN substrate PIP₃ (Fig. 2B) and increased Akt phosphorylation (Fig. 2C). Direct interaction between the tested miRNAs and PTEN mRNA was verified with chimerical luciferase plasmids in which appropriate fragments of PTEN 3′UTR were cloned downstream of the luciferase reporter gene (Fig. 2D and fig.S1, B to D).

Individual miRNAs binding to different seed matches on the same 3′UTR generally cooperate in translational repression (23). Indeed, we found that the combination of a representative miRNA for each of the families was more effective than any single miRNA at decreasing PTEN abundance (fig. S3A).

Finally, to validate that the PTEN-_targeting miRNAs we identified exerted their biological activity through their effects on PTEN, we generated DU145 cell lines stably transfected with short hairpin RNA (shRNA) _targeting a control gene Renilla luciferase (sh-Ren) or human PTEN (sh-PTEN). When sh-Ren–expressing cells were transiently transfected with a mix of antisense inhibitors of the identified PTEN-_targeting miRNAs (I-mix), PTEN abundance increased (Fig. 2E, top) and proliferation decreased (Fig. 2E, bottom) compared to cells transfected with a control miRNA inhibitor (I-C). In contrast, sh-PTEN–expressing cells, which had undetectable PTEN, showed no response to I-mix. These findings indicate that PTEN _targeting is necessary for the growth-promoting effects of members of the different miRNA families.

PTEN-_targeting miRNAs and DICER are abundant in human prostate cancer

Small differences in Pten abundance have marked consequences on prostate cancer initiation and progression (13); thus, we evaluated the possible involvement of the PTEN-_targeting miRNA families in the context of human prostate cancer cell lines and primary human prostate tumor samples. Based on our analysis, PTEN-_targeting miRNAs are organized into nine independent genomic clusters (Fig. 1B). We focused on four loci representative of the five PTEN-_targeting miRNA families: miR-22, miR-371∼373, and the paralogous miR-17∼92 and miR-106b∼25 clusters (Fig. 1B and table S2).

We performed real-time reverse transcription polymerase chain reaction (RT-PCR) on two prostate cell lines derived from normal epithelium, two derived from primary prostate carcinoma, and five derived from distant prostate carcinoma metastases. miR-22 was more abundant in both cell lines derived from primary carcinomas and in three of the five metastatic cell lines than in the lines derived from normal epithelium, suggesting that this miRNA might play a role in prostate cancer progression (Fig. 3A). A robust increase in the abundance of the three PTEN-_targeting components located in the miR-106b∼25 cluster (miR-25, miR-93, and miR-106b) was observed in all the prostate cancer cell lines compared to that in the normal cell lines (Fig. 3B). Of the PTEN-_targeting members of the miR-17∼92 cluster, abundance of only miR-19a was increased (Fig. 3C). This suggests that, although both the miR-106b∼25 and the miR-17∼92 clusters contain members of the same PTEN-_targeting miRNA families, only those in the first cluster are associated with prostate tumorigenesis. The PTEN-_targeting members of the miR-371∼373 cluster (miR-372 and miR-373) were not detectable in all the cell lines analyzed [see also (24)]. Therefore, this cluster was not investigated further.

The abundance of miR-22, miR-25, miR-93, and miR-106b was next examined by in situ hybridization (ISH) on a prostate tumor tissue microarray (TMA). This TMA contains 184 cases of tumor and matched nontumor tissues (table S3). miRNA abundance was scored as described in fig. S4. ISH showed that miR-22, miR-25, miR-93, and miR-106b were absent in most of the nontumor tissue samples, confirming the RT-PCR results in the cell lines derived from normal prostatic epithelium. Up to 53% of the tumor samples were, however, positive for these miRNAs (Fig. 4, A and B). TMA samples characterized as prostatic intraepithelial neoplasia (PIN, an early noninvasive malignant lesion of the prostate epithelium) consistently showed intermediate positivity (25 to 45% of positive cases for each miRNA). These results are in agreement with miRNA array data reported elsewhere (25, 26).

To confirm that miR-22, miR-25, miR-93, and miR-106b are bona fide PTEN-_targeting miRNAs, we measured PTEN abundance by immunohistochemistry (IHC) in the same TMA. We identified a highly significant, inverse correlation between the abundance of PTEN and that of each of the four miRNAs (Figs. 4, C and E, and 5). Furthermore, we detected a direct correlation between each miRNA and phosphorylated Akt (pAkt) (Figs. 4, D and E, and 5). We also found that the concomitant presence of candidate miRNAs increased the probability of observing Akt phosphorylation in the TMA samples (fig. S5).

We also investigated the abundance of DICER, the enzyme that cleaves pre-miRNAs to release mature miRNAs, by IHC in the same TMA. We observed that increased DICER abundance was associated with tumor progression (Fig. 6, A and B). This finding is confirmed by analysis of an independent TMA (4) and is consistent with the observation that the oncogenic factor SOX4 increases DICER transcription (27). We also found a direct correlation between overexpression of candidate miRNAs and that of DICER (table S4 and Figs. 4E and 6C), suggesting that aberrant maturation contributes to the increase in abundance of these miRNAs.

miR-22 is a proto-oncogene

We performed transformation assays on mouse embryonic fibroblasts (MEFs) and found that miR-22 cooperated with the proto-oncogene c-MYC, proof of principle of its proto-oncogenic capacity (Fig. 7A). We also tested the ability of miR-22 to potentiate the proliferation of human prostate cancer cells. We generated DU145 cells that stably expressed a retroviral pri-miR-22 (PIG/22 cells), in which PTEN abundance and activity was decreased relative to that in control cells (Fig. 7B), and found that they formed greater numbers of colonies in soft agar compared to control cells (Fig. 7C). To determine whether the effects of miR-22 depended on decreased PTEN abundance, we retrovirally transduced DU145 cells with both pri-miR-22 and PTEN lacking its 3′UTR, so that it could not be _targeted by miRNAs. Exogenous 3′UTR-less PTEN overcame the proliferation-promoting effect of miR-22, indicating that this miRNA depends on PTEN down-regulation to exert its biological activity (Fig. 7D). When injected subcutaneously into the flank of nude mice, PIG/22 cells showed a proliferative advantage, as indicated by their generation of tumors that were twice the size of those generated by PIG-infected cells after 6 to 7 weeks of growth (Fig. 7E). miR-22 overexpression (Fig. 7, F, left, and G) and the concomitant decrease in PTEN mRNA abundance (Fig. 7F, right) were confirmed in PIG/22-derived tumors. These tumors demonstrated a proliferation rate higher than that of PIG-derived tumors, as shown by increased Ki67 staining, as well as a highly phosphorylated Akt as detected by IHC (Fig. 7G), both suggestive of hyperactivation of the Akt pathway.

Two potentially oncogenic elements—miR-106b∼25 and MCM7—are present in the same locus

All three components of the miR-106b∼25 cluster _targeted PTEN (Fig. 2A) and cooperated in decreasing PTEN abundance (fig. S3B). Thus, we analyzed this cluster for its oncogenic potential, with particular emphasis to its genomic context. miR-106b∼25 is located within intron 13 of the minichromosome maintenance protein 7 (MCM7) gene. MCM7 is one of six members of the highly conserved MCM2 to MCM7 family of DNA helicases that are essential for the initiation of DNA replication in eukaryotes (28). The abundance of MCM7 is commonly increased in human cancers and it is widely used as a diagnostic (29, 30) and prognostic (31) marker.

We first tested the proliferative consequences of overexpressing the miR-106b∼25 cluster by infecting DU145 prostate cancer cells with a retroviral vector expressing the ∼800–base pair (bp)-long intron that functions as pri-miRNA (PIG/106b∼25). miR-106b∼25–overexpressing cells showed decreased PTEN abundance and activity (fig. S6A) and an increased capacity to form colonies in soft agar (fig. S6B). To determine whether miR-106b∼25 functions through its effects on PTEN, we infected cells with the exogenous 3′UTR-less form of PTEN, which markedly decreased the number of colonies formed in soft agar by miR-106b∼25–overexpressing cells (fig. S6C). This indicates that the miR-106b∼25 cluster exerts its tumorigenic activity through a decrease in PTEN. The incomplete rescue by exogenous PTEN may be attributed to the ability of the three miRNAs in this cluster to _target genes other than PTEN (table S2). This notion is supported by the observation that an inefficient shRNA that decreased PTEN abundance to an extent similar to that elicited by the miRNAs was less effective than the miRNAs in promoting colony formation (compare fig. S7A with fig. S6B). miR-106b∼25–overexpressing cells were also injected subcutaneously into nude mice, where they formed bigger tumors compared to that in control cells (Fig. 8A; see fig. S6, D and E, for the analysis of the xenograft).

To further investigate the oncogenic capabilities of miR-106b∼25, we performed transformation assays in MEFs. Although miR-106b∼25 expresses miRNAs belonging to different families (miR-25 and miR-93/106b), it behaved as a single functional unit that cannot efficiently transform MEF on its own (Fig. 8B). This is consistent with the fact that, in most of the cases, the three miRNAs share an expression pattern (Fig. 6D) and confirms that lowering Pten alone is not sufficient to confer fullblown transformation in MEFs (32). However, the miR-106b∼25 cluster transformed MEFs when combined with c-MYC or MCM7 (Fig. 8B). A specific decrease in Pten abundance by an shRNA shows the same pattern of transformation (sh-Pten + c-MYC and sh-Pten + MCM7), although with lower efficiency, suggesting that Pten _targeting is required by the intronic miRNAs to transform MEFs (fig. S7B).

Cooperation of miR-106b∼25 and MCM7 in cellular transformation indicates that the MCM7 locus contains not one, but two oncogenic units. To validate this notion, we generated a construct that drives the expression of both the miR-106b∼25 cluster and MCM7 protein from the same TU (PIG/MCM7i13), mimicking the organization of the MCM7 locus itself (Fig. 8C; see fig. S8 for the characterization of the chimerical construct). Only the PIG/MCM7i13 and not control constructs transformed MEFs (Fig. 8D), providing further evidence that this locus contains two oncogenic elements that promote cellular transformation.

The MCM7 locus can initiate prostate tumorigenesis

To characterize the role of the bi-oncogenic MCM7 locus in prostate tumorigenesis in vivo, we generated a transgenic mouse model in which human MCM7 protein and the PTEN-_targeting miR-106b∼25 intronic cluster were selectively overexpressed in prostate epithelium. We placed the MCM7i13 construct described above (Fig. 8C) under the control of the prostate-specific rat probasin promoter ARR₂PB (subsequently referred to as Pb) (33, 34). Pronuclear injection of the Pb/MCM7i13 transgenic construct (Fig. 9A) resulted in the generation of nine independent lines of mice, as indicated by Southern blot (Fig. 9B, top) and PCR (Fig. 9B, bottom) analyses. Prostate-specific expression of the transgenic mRNA was determined by real-time PCR in these nine lines (1, 2, 12, 18, 21, 37, 46, 54, and 62). Line 21 did not show any expression of the transgene; the other transgenic lines were characterized as low expressors (LE; lines 12, 37, and 46), medium expressors (MEs; lines 1, 2, and 62), and high expressors (HEs; lines 18 and 54) (Fig. 9C and fig. S9A). In these mice, overexpressed MCM7i13 mRNA abundance was mirrored by an increase in the abundance of mature miR-106b, 93, and 25 (fig. S9B). Real-time PCR data were confirmed by MCM7 and miR-93 detection in preneoplastic prostates by IHC and ISH, respectively (fig. S9C).

Next, we examined the incidence of prostate-specific lesions in a cohort of 1-year-old transgenic mice from the various lines. Although the anterior (AP) and ventral (VP) prostates appeared normal, the dorsolateral prostates (DLPs) displayed multifocal proliferative lesions, the severity of which was directly correlated with expression of the transgene (Fig. 10A). LE lines manifested signs of hyperplasia, whereas ME and, to a greater extent, HE lines developed the distinctive architectural growth features that characterize PIN, including hyperplastic growth in disorganized multicellular layers, loss of epithelial cell polarity, nuclear atypia (large and irregular nuclei and prominent nucleoli), aberrant mitotic activity (Fig. 10B, left panels, dotted arrow), and cribriform growth patterns with intraepithelial lumen formation (Fig. 10B, left panels, straight arrows). Hyperproliferation was confirmed by an increase in the proliferation-specific marker Ki67 (Fig. 10B, right panels), and hyperactivation of the Akt pathway as a result of Pten down-regulation (Fig. 10C) was reflected by an increase in phosphorylation of Akt (Fig. 10C) and of its downstream effector S6 (36) (Fig. 10B, middle panels). Thus, the combined overexpression of MCM7 and its host miRNA cluster can initiate prostate tumorigenesis.

We also generated a transgenic mouse model in which human MCM7 protein alone was selectively _targeted to prostatic epithelium (fig. S10A). Two independent lines with varying MCM7 expression were studied further. Pb/MCM7 line 88 expressed the transgenic construct in amounts comparable to those of Pb/MCM7i13 line 18 (fig. S10B). Nonetheless, none of the mice from these two lines developed cancer or an overt phenotype by 1 year of age (fig. S10, C and D). This indicates that MCM7 alone cannot initiate tumorigenesis in the prostate.

Reagents

The following antibodies and reagents were used: antibodies against Hsp-90 #61041 (Becton Dickinson); PTEN #9559 (WB), pAkt (Ser⁴⁷³) #9271 (WB), #3787 (IHC), Akt #9272, pS6 #2211 (Cell Signaling); DICER #CG006 (Clonegene); MSCV-neo (Clontech); siGENOME non-_targeting small interfering RNA (siRNA) #2 (si-Luc), si-miR-19a, si-miR-19b, si-miR-22, si-miR-25, si-miR-92a, si-miR-17, si-miR-20a, si-miR-93, si-miR-106b, si-miR-302a, si-miR-372, si-miR-373, si-PTEN, siGLO RISC-free control siRNA miRNA antisense inhibitor negative control #1, miR-19a antisense inhibitor, miR-22 antisense inhibitor, miR-25 antisense inhibitor, miR-93 antisense inhibitor, miR-106b antisense inhibitor, Dharmafect 1 (Dharmacon); miR-17, miR-19a, miR-20a, miR-22, miR-25, miR-93, and miR-106b 3′ digoxigenin (DIG)–labeled LNA ISH probes (Exiqon); lipofectamine 2000, Trizol reagent, deoxyribonuclease I (DNase I) amplification grade, SuperScript II reverse transcriptase, Dulbecco's modified Eagle's medium (DMEM), RPMI 1640, fetal bovine serum (FBS), keratinocyte serum-free medium, epidermal growth factor (EGF), bovine pituitary extract (BPE), antibody against Xpress Tag, pcDNA3.1/His C, geneticin (G418), hygromycin, antibody against PTEN (IHC) #51-2400 (Invitrogen); human MCM7 complementary DNA (cDNA) #MHS1011-75176 (Open Biosystems); pGL3-Control (Firefly luciferase), pRL-TK (Renilla luciferase), Dual-Luciferase reporter assay (Promega); fraction V bovine serum albumin (BSA), polybrene, insulin, antibody against actin #A3853, anti-FLAG antibody #F3165, puromycin (Sigma); QuantiTect Sybr Green PCRkit (Qiagen); antibody against MCM7 #9966 (Santa Cruz Biotechnology); QuikChange II XL Site-Directed Mutagenesis Kit, Herculase Taq polymerase (Stratagene); Ki67 antibody #VP-K451 (Vector Laboratories).

Plasmids

To construct the p1 and p2 chimeric luciferase plasmids, we removed the multicloning site of pGL3-control plasmid from its original position and inserted it into the Xba I site located downstream of the luciferase STOP codon. In this way, pGLU plasmid was obtained. An ∼1.7- (p1) or 0.5-kilo–base pair (kbp) (p2) fragment of PTEN 3′UTR was then amplified from genomic DNA and cloned into the Kpn I and Xho I sites of pGLU. The QuikChange II XL Site-Directed Mutagenesis Kit was used to generate the mutated forms of these plasmids (fig. S1C).

PIG/22 retroviral vector was obtained by cloning a ∼0.55 genomic fragment encompassing human pri-miR-22 into Bgl II and Xho I sites of MSCV-PIG (51) vector (puromycin resistance). The ∼0.8–kbp-long intron 13 of human MCM7 was cloned analogously and PIG/106b∼25 vector was obtained. The corresponding MSCV plasmids (hygromycin resistance) were obtained by subcloning in Bgl II and Xho I sites.

MSCV-neo-Flag-PTEN was generated by cloning the open reading frame of human PTEN (NM_000314.4) in the Eco RI and Xho I sites of MSCV-neo. The Flag epitope (AspTyrLysAspAspAspAspLys) was then inserted upstream of the ATG in Eco RI.

pSUPER-shEGFP and pSUPER-sh-Pten plasmids were previously generated in the laboratory (32). sh-Pten is complementary to nucleotides 274 to 291 in the open reading frame of both mouse and human PTEN.

Cells and culture conditions

Wild-type MEFs were isolated from 13.5-day mouse embryos. After the legs, tail, liver, and head were removed, each embryo was mechanically fragmented and then incubated with trypsin–phosphate-buffered saline (PBS) 1:3 (10 ml total) at 37°C for 5 min. Five milliliters was removed and collected in 20 ml of DMEM + 10% FBS. Fresh trypsin (5 ml) was then added and the above-mentioned procedure was repeated three to four times. The collected cells were then spun down and seeded in a 6-cm dish. Cells were trypsinized at confluency (passage 1, P1). The propagation protocol 3T9 (9 × 10⁵ cells per 100–mm-diameter dish transferred every 3 days) was followed. MEFs at P1 to P3 were used.

U2OS, Phoenix A and E cells were grown in DMEM +10% FBS. RWPE-1, PWR-1E, and Ca-HpV-10 were grown in keratinocyte medium + EGF + BPE. 22Rv1, DU145, LnCap, MDA-PCa-2b, and PC3 were grown in RPMI 1640 + 10% FBS. All cell lines were obtained from American Type Culture Collection and grown in penicillin-streptomycin and glutamine-containing medium at 37°C in a humidified atmosphere with 6% CO₂.

Dual-luciferase reporter assay

DU145 cells were seeded at a density of 6 × 10⁴ cells per 24-well plate. Twenty-four hours later, 400 ng of p1 or p2 plasmid per well were cotransfected with 80 ng of pRL-TK. Lipofectamine 2000 was used as transfectant according to the manufacturer's recommendations. Twenty-four hours after transfection, luciferase activity was measured and normalized as in (20). In the case of plasmid-miRNA inhibitor cotransfection, 200 ng of p1/p1-mut-17/302 and 10 nmol of I-C/I-93 were transfected. Cells were analyzed as described above.

Transient transfection

DU145 (1.5 × 10⁵) and PWR-1E (0.8 × 10⁵) were seeded in 12-well dishes, respectively. The following day they were transfected with 100 nM siRNAs/si-miRNAs or 400 nM miRNA inhibitors with Dharmafect 1 according to the manufacturer's recommendations. With this protocol, more than 90% of cells were positive for the fluorescent siGLO RISC-free control siRNA. Six hours after transfection, cells were seeded for growth curves (see below). Otherwise, the day after transfection, cells were trypsinized and reseeded in 12-well plates for subsequent collection and analysis.

DU145 and MEF retroviral infection

For retrovirus-mediated gene transfer of DU145, Phoenix A cells (3 × 10⁶) were plated in a 10-cm poly-d-lysine–coated dish and, 16 hours later, were transfected with PIG retroviral plasmids using Lipofectamine 2000. Forty-eight hours later, the virus-containing medium (10 ml) was filtered and mixed with 5 ml of freshly prepared medium supplemented with polybrene (4 μg/ml). Cells (5 × 10⁵) were plated in a 10-cm dish. Sixteen hours later, the medium was replaced with viral supernatant. Puromycin (2 μg/ml) was administered 48 hours after infection. The cells were selected for 2 days and then used for the various assays. For double infection, Phoenix A cells were transfected with empty PIG or the miRNA-expressing plasmids (PIG/22, PIG/106b∼25), which carry puromycin resistance, and MSCV-neo empty or MSCV-neo-Flag-PTEN plasmids, which carry G418 resistance. The medium for infection contained 5 ml of freshly prepared medium, 5 ml of puro-resistant viral supernatant, and 5 ml of G418-resistant viral supernatant. Selection with puromycin (2 μg/ml) + G418 (500 μg/ml) was started 48 hours after infection and continued for 1 week. The selection medium was changed daily.

Double infection of MEF was performed similarly, except that Phoenix E cells instead of A cells were used. Phoenix E cells were transfected with MCSV/22 or MCSV/106b∼25 plasmids, which carry hygromycin resistance (51), and PIG/c-MYC, PIG/RasV¹², PIG/E1A (51), or PIG/MCM7 puromycin-resistant plasmids. For sh-Pten experiments, Phoenix E cells were transfected with pSUPER-shPten, which carries puromycin resistance, and MSCV/c-MYC, MSCV/RasV¹², MSCV/E1A, or MSCV/MCM7 hygromycin-resistant plasmids. The medium used to infect MEFs contained 5 ml of freshly prepared medium, 5 ml of hygromycin-resistant viral supernatant, and 5 ml of puromycin-resistant viral supernatant. Forty-eight hours after infection, selection was started and carried on for 4 days [the first two with puromycin (2 μg/ml) + hygromycin (75 μg/ml), the second two with only hygromycin (75 μg/ml)]. The selection medium was changed daily.

Phosphoinositide analysis

DU145 cells were seeded at 3 × 10⁵ cells per six-well dish. The following day, they were transfected with the different si-miRNAs as described. Six hours after transfection, cells of one six-well plate were trypsinized and replated in two 10-cm plates. The following day, they were labeled for 24 hours with [³H]inositol (10 mCi/ml) for 24 hours in inositol-free DMEM supplemented with 10% FBS and 0.5% BSA. They were then serum-starved for 24 hours in inositol-free DMEM with [³H]inositol (10 mCi/ml) and 0.5% BSA, but without FBS. After 5 min of stimulation with 200 nM insulin, cells were lysed in 1 M HCl. Lipids were extracted in chloroform-methanol (1:1, vol/vol) and deacylated as described (52). Phosphatidylinositides were separated by anion-exchange high-performance liquid chromatography (Beckman), detected by a flow scintillation analyzer (Perkin-Elmer), and quantified with ProFSA software (Perkin-Elmer). The ³H-labeled PI3P (phosphatidylinositol 3-phosphate), PIP₂, and PIP₃ peaks were identified by ³²P-labeled in vitro synthesized internal lipid standards, prepared with baculovirus-expressed PI3K. For the [³H]inositol labeling, the counts in each peak were normalized against the counts found in the phosphatidylinositol peak.

PCR analysis

Total RNA was extracted with Trizol reagent according to the manufacturer's instructions.

Mature miRNAs were detected with TaqMan miRNA assays (Applied Biosystems) at the Biopolymers Facility (Harvard Medical School). RNU24 (human) or sno202 (mouse) were used as internal standards.

To determine the length of PTEN 3′UTR, total RNA was subjected to DNase treatment and retrotranscription (1 μg of RNA per vial). PCR was then performed with Herculase Taq polymerase.

To evaluate hPTEN, mPten, hMCM7, and intron 13 mRNA concentrations, real-time PCR was carried out with Sybr Green fluorescence. Two microliters of cDNA was used in a 20-μl reaction. ACTIN (human) or GAPDH (mouse) was used as an internal standard.

Relative quantification of gene expression was performed with the comparative C_T method (53).

Western blot

Transfected cells grown for specified time points were collected and lysed [50 mM tris (pH 8.0), 1 mM EDTA, 1 mM MgCl₂, 1% NP-40, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, 1 mM NaF, and protease inhibitors]. Proteins (30 μg per lane) were separated on 10% SDS–polyacrylamide gel and transferred to nitrocellulose membranes. Immunoblotting of the membranes was performed with the following primary antibodies: antibodies against PTEN (1:1000), Flag (1:1000), pAkt (Ser⁴⁷³) (1:1000), Akt (1:1000), MCM7 (1:2000), XPress (1:1000), Actin (1:10000), and Hsp90 (1:1000). Signals were revealed after incubation with the recommended secondary antibody coupled to peroxidase by enhanced chemiluminescence. Scanned images were quantified with ImageJ software.

In situ hybridization

ISH on TMAs was performed on 5-μm paraffin sections with 3′ DIG– labeled miRNA LNA (locked nucleic acid) probes with an automatic stainer (Discovery XT, Ventana Medical Systems Inc.). Cells were baked overnight at 60°C, dewaxed, postfixed in 4% paraformaldehyde (PFA) for 12 min, and then digested in proteinase K solution (15 μg/ml) for 4 min. Hybridization was performed overnight at 22°C below the melting temperature (T_m) of each probe with a commercial hybridization buffer (RiboHybe, Ventana Medical Systems). Two 16-min posthybridization washes in 2× SCC were performed at 4°C above the hybridization temperature. Then, sections were incubated for 40 min with a biotinylated antibody against DIG (InnoGenex). Detection with streptavidin–alkaline phosphatase and BCIP/NBT (bromochloroindolyl phosphate–nitro blue tetrazolium) substrates was performed for 10 hours with the BlueMap kit (Ventana Medical Systems). A Nikon Eclipse 50i microscope was used.

Immunohistochemistry

IHC was performed on 5-mm paraffin sections with the avidin-biotin-peroxidase method. The following primary antibodies were used: Ki67 (1:1000), pAkt (Ser⁴⁷³) (1:30), PTEN (1:100), pS6 (1:500), and DICER (1:250). Antigen retrieval was performed with citrate buffer (Ki67, DICER, pS6, PTEN) or 1 mM EDTA solution (pAkt). pAkt staining was considered specific only when cytoplasmic, and tumor cases were considered positive when staining in neoplastic cells was stronger than in normal prostate epithelium. PTEN abundance was scored semi-quantitatively with an intensity × quantity product (intensity: 0 = negative, 1 = weak, 2 = moderate, 3 = strong; quantity: 0 = negative, 1 = 1 to 9% of examined cells positive, 2 = 0 to 39% of cells positive, 3 = 40 to 69% of cells positive, 4 = 70 to 100% of cells positive). Scores ranging from 0 to 12 were averaged across replicate cores. For DICER, a classic three-category–based score was used, as shown in Fig. 6A. A Nikon Eclipse 50i microscope was used.

Cell proliferation

Six hours after transfection, the cells of one 12-well dish were trypsinized, resuspended in 50 ml of medium, and plated in eight sets of three wells of a 12-well plate. Starting from the following day (day 0), 1 set of wells per day was washed once with PBS, fixed in 10% formalin solution for 10 min at room temperature, and then kept in PBS at 4°C. At day 7, all the wells were stained with crystal violet. After lysis with 10% acetic acid, the absorbance was read at 595 nm.

Growth in semisolid medium

The bottom layer was obtained by covering six-well dishes with 3 ml of 0.6% agar in DMEM. The following day, 5 × 10⁴ infected cells were plated on this bottom layer in triplicate in 2 ml of 0.3% agar in DMEM + 10% FBS. Colonies were counted after 3 to 4 (DU145) or 4 to 6 (MEF) weeks at 40× and 100× magnification, respectively. Five fields for each well were counted. A Nikon Eclipse TE300 microscope was used. Images were acquired with IPLab software.

Injection into nude mice

NCR nude mice strain (4 to 6 weeks old; Taconic) were subcutaneously injected into the right flank with 4 × 10⁶ infected cells. Tumor size was assessed weekly by caliper measurement. Tumor volume was calculated with the formula D × d² × π/6, where D and d are the long and the short sides of the tumor.

Patient material and TMAs

Four TMAs were constructed from archival formalin-fixed, paraffin-embedded (FFPE) radical prostatectomy specimens from 184 cases of prostate cancer from the Department of Pathology of Brigham and Women's Hospital. Representative regions of each tumor were selected for coring on the basis of the corresponding hematoxylin and eosin (H&E)–stained full section. Three 0.6-mm-diameter cores of each tumor were included in the TMAs along with three cores of normal prostate tissue from the same patient (for 177 cases). Three cores with foci of PIN were available for 24 cases. Informed written consent was obtained from all patients, and the use of patient material in this study was approved by our internal institutional review board. Clinicopathological characteristics of the cohort of patients included in the study are summarized in table S3.

Generation of MCM7 and MCM7i13 transgenic mice

Inserts from pcDNA/MCM7 and pcDNA/MCM7i13 plasmids (fig. S8A) were excised by Hind III/Eco RI digestion and ligated to the Pst I/Eco RI– restricted ARR₂PB-containing plasmid (33), after blunting one extremity to obtain the Pb/MCM7 and the Pb/MCM7i13 plasmids. The fragments containing Pb-MCM7-SV40polyA and Pb-MCM7i13-SV40polyAwere released by Not I/Pvu I digestion and injected into the pronuclei of fertilized oocytes in a B6/CBA F1 hybrid background. Southern blot analysis was performed according to standard procedures. The PCR primers used for genotyping are the following: forward primer, 5′ GCTAGAACTAGTGGATCCCCC 3′, and reverse primer, 5′ CATCGTCGTACAGATCCCGAC 3′

Mouse histopathology

Prostates were extracted from euthanized mice and fixed in 4% PFA overnight at 4°C. They were then transferred into 70% ethanol, embedded in paraffin, sectioned and stained with H&E in accordance with standard procedures. IHC and ISH on prostate sections were performed as described above.

Statistical analysis

In vitro and in vivo data were analyzed with unpaired t test (GraphPad Prism, GraphPad Software Inc.). Values of P < 0.05 were considered statistically significant (*P < 0.05; **P < 0.01; ***P < 0.001). The mean ± SD of three independent experiments is reported. Chi-squared test was used for the analysis of TMA samples (http://www.quantpsy.org).