The kielin/chordin-like protein (KCP) attenuates high-fat diet-induced obesity and metabolic syndrome in mice

KCP transgenic mice are protected from diet-induced obesity

We had created a kcp^−/− allele by conventional gene _targeting (27) and a kcp^Tg allele using the mouse PEPCK promoter driving the KCP cDNA coding region with an amino-terminal human Igκ secretory signal and a carboxyl-terminal myc epitope tag (31). Both kcp^−/− and kcp^Tg mice were viable and fertile with no gross morphological defects. As reported previously, aged kcp^−/− mice exhibit liver pathology that was accentuated when the mice were put on a high-fat diet to induce obesity (32). To more precisely quantitate the changes in body mass, growth curves were determined for kcp^−/−, kcp^+/+, and kcp^Tg mice when fed a ND or HFD (Fig. 1, A and B). On normal diet, both kcp^+/+ and kcp^−/− mice were on average about 25% heavier than kcp^Tg. After 12 weeks on a high-fat diet, both kcp^+/+ and kcp^−/− were more than 80% heavier than the kcp^Tg mice. In fact, the kcp^Tg mice did not gain significantly more weight on the high-fat diet compared with the normal diet. We did not observe any gross skeletal abnormalities or evidence of dwarfism as body lengths were not significantly different between the genotypes. Body composition analyses indicated that the difference in body weights on both diets between WT or kcp^−/− and the kcp^Tg mice was due in large part to less white adipose tissue in the kcp^Tg mice with no significant difference in fluid composition (Fig. 1, C and D).

Obesity-induced metabolic disorder in mice can lead to glucose intolerance and insulin resistance. To assess the effects of KCP loss and overexpression on glucose metabolism, we performed glucose tolerance testing (Fig. 1, E and F). kcp^+/+, kcp^−/−, and kcp^Tg mice maintained on normal diets had similar glucose tolerance. However on the high-fat diets, the kcp^+/+ and kcp^−/− mice had impaired glucose tolerance compared with their lean counterparts, whereas the kcp^Tg mice showed glucose uptake similar to the mice on a normal diet (180 ± 25 mg/dl after 15 min). In those mice, fasting insulin levels were significantly higher in the kcp^−/− animals, consistent with the development of glucose intolerance (Fig. 1G).

Metabolic profiles of KCP transgenic and mutant mice

To evaluate the mechanism of impaired weight gain in the kcp^Tg mice, we first measured average body temperatures as an indicator of metabolic function and thermoregulation. The kcp^Tg mice had significantly higher average body temperatures, almost a full degree more, than kcp^+/+ or kcp^−/− mice regardless of the diet conditions (Fig. 1H). Subsequently, mice of all three genotypes were fed either normal or high-fat diets for 8 weeks and then adapted to single metabolic cages for 4 weeks. Multiple metabolic parameters were then measured over a 3-day time period (Fig. 2A). Among the mice fed a normal diet, the only significant difference among the genotypes was that the kcp^Tg mice oxidized more glucose compared with kcp^+/+ and kcp^−/−. However, the mice kept on a HFD exhibited multiple differences among the three genotypes. The kcp^Tg mice had higher total energy expenditure compared with kcp^+/+, whereas the kcp^−/− mice expended less energy than kcp^+/+. The differences are best illustrated in average oxygen consumption, as adjusted for lean body mass, over the light and dark cycles of a 3-day test period (Fig. 2B). The kcp^Tg mice used ∼14% more oxygen compared with kcp^+/+, whereas the kcp^−/− mice used 25% less oxygen over the 3-day period. Similar statistically significant data can be seen when energy expenditure is averaged over time for the three genotypes (Fig. 2C). The increased energy expenditure in kcp^Tg mice was not reflected by any more activity or any more food consumption as there were no significant differences among the three genotypes. The kcp^Tg mice were able to oxidize more glucose and fat compared with kcp^+/+, whereas kcp^−/− mice oxidized less glucose but similar amounts of fat compared with kcp^+/+.

The increased energy and oxygen consumption, despite no change in food intake or activity, are consistent with the significantly increased body temperature in kcp^Tg mice and suggest altered thermoregulation. To determine whether this was due to a neuroendocrine effect or responsiveness to norepinephrine (NE), we challenged the mice with a single dose of NE and measured the metabolic rates (Fig. 2D). Mice were kept at a thermoneutral temperature of 30 °C and anesthetized for baseline readings. Subsequently, a single injection of NE significantly increased respiration and energy expenditure in all three genotypes with no significant differences. The three genotypes were also subjected to a series of temperature challenges by first housing mice at 22 °C for 1 day, 30 °C for another day, and then 4 °C for 2 days (Fig. 2E). All three genotypes exhibited a decrease in energy expenditure and oxygen consumption at 30 °C followed by a nearly 3-fold increase in energy expenditure at 4 °C. As previous results indicated, average body temperatures at 22 °C were significantly higher in kcp^Tg mice, but this effect was reduced at 30 °C (Fig. 2F). Strikingly, at 4 °C, average subcutaneous body temperatures appeared lower in the kcp^Tg mice, which may reflect the reduced amount of insulating subcutaneous body fat in these animals.

KCP alters white and brown adipose tissues

To determine the mechanisms underlying the reduced amount of white adipose tissue in kcp^Tg mice, we characterized both white and brown adipose tissues in mice kept on a HFD. Although kcp^Tg mice had less visceral fat, we were able to isolate enough epididymal WAT (eWAT) for histology and protein expression analyses. By Western blot analyses, kcp^Tg eWAT had significantly lower levels of P-SMAD3 but higher levels of P-SMAD1 compared with either kcp^+/+ or kcp^−/− eWAT (Fig. 3, A and B). These data are entirely consistent with prior results showing inhibition of TGF-β signaling and enhancement of BMP signaling by KCP protein. Furthermore, the kcp^Tg eWAT had higher levels of UCP1, which increases heat production and is usually associated with brown fat (Fig. 3, A and C). The kcp^Tg eWAT tissues also had higher levels of PPARγ, PGC1, P-AKT, and cytochrome c oxidase subunit IV, all proteins associated with a more beige fat phenotype (Fig. 3, A and C). Also of note were the increased levels of P-ERK in the kcp^−/− eWAT; P-ERK is known to phosphorylate PPARγ and increase expression of diabetes-associated genes (33). We also used quantitative RT-PCR to assess gene expression for adiponectin, kcp, and pgc1 (Fig. 3D), all of which were higher in the kcp^Tg mice and lower in the kcp^−/− mice compared with the kcp^+/+ animals.

In mice fed a HFD, the eWAT tissue also exhibited differences in histology and in markers for inflammation among the three genotypes (Fig. 4). Trichrome staining showed extracellular collagen deposition in kcp^−/− eWAT with many large adipocytes and evidence of enhanced inflammation. The average cross-sectional area of eWAT cells was approximately half in kcp^Tg adipocytes, whereas the kcp^−/− adipocytes were even larger than kcp^+/+ cells (Fig. 4, A–C and J). Whole-mount immunofluorescence examined macrophage infiltration and crownlike structures in eWAT as a measure of the inflammatory response that correlates with high-fat diet-induced obesity and glucose intolerance (Fig. 4, D–F and K). The kcp^Tg mice had few if any crownlike structures and MAC2-positive macrophages in eWAT. However, the obese kcp^+/+ and especially the kcp^−/− animals had large numbers of macrophages present in eWAT. We also looked for evidence of fibrosis by Picrosirius Red staining for collagen deposition. The kcp^−/− animals showed increased collagen matrix deposition in eWAT compared with kcp^+/+ mice, whereas the kcp^Tg mice had significantly less collagen deposition when fed a high-fat diet (Fig. 4, G–I and L).

Given the increased body temperature and metabolism in kcp^Tg mice, we also examined interscapular brown adipose tissue (iBAT) for protein expression and histology. Protein expression levels in iBAT of mice fed a ND showed that kcp^Tg mice had elevated levels of P-SMAD1 and PPARγ but no significant differences in UCP1 (Fig. 5, A–C). The kcp^−/− mice showed slightly more P-SMAD3 and less PPARγ but no significant differences in P-SMAD1 or UCP1 compared with kcp^+/+ animals (Fig. 5, A–C). The kcp^Tg mice also demonstrated myc-KCP expression in iBAT, indicating that the PEPCK promoter used for the transgene is actively expressed in this tissue. When mice were kept on a HFD, differences in protein expression levels in iBAT from kcp^Tg and kcp^−/− mice were more pronounced (Fig. 5, D–F). kcp^−/− mice had less P-SMAD1 and higher levels of P-SMAD3 compared with kcp^Tg mice (Fig. 5F). In addition, levels of P-ERK were higher in kcp^−/− mice. Levels of UCP1 were significantly higher in kcp^Tg mice as were PGC1 and PPARγ (Fig. 5E) compared with kcp^−/− mice.

Histology of iBAT indicated that the kcp^−/− mice fed a normal diet exhibited increased lipid storage in iBAT, compared with WT, that became even more pronounced on the HFD (Fig. 6). Histology of BAT generally shows densely staining cytoplasm because of the density of mitochondria that fuel thermoregulation. Consistent with our metabolic data, kcp^Tg mice had very densely staining iBAT compared with WT on both normal diet and HFD (Fig. 6) with only minimal lipid accumulation.

Finally, to test whether the differences in brown and white adipocytes were cell-autonomous and could reflect the response to TGF-β superfamily ligands, we cultured differentiated adipocytes isolated from inguinal WAT and interscapular BAT tissues of all three genotypes kept on a ND (Fig. 7). Differentiated adipocytes isolated from inguinal white adipose tissue (iWAT) showed that the kcp^Tg cells had a stronger response to BMP4 with higher levels of P-SMAD1 (Fig. 7A). Cells isolated from kcp^−/− mice showed a higher basal level of P-SMAD3 and a stronger response to TGF-β despite having less total SMAD3. Also of note, the kcp^Tg cells expressed more UCP1, suggesting a more beige phenotype. The differentiated adipocytes isolated from iBAT showed a weaker BMP4 response in kcp^−/− cells but no difference in the kcp^Tg cells. P-SMAD3 was not significantly affected in iBAT cells. However, kcp^−/− cells had significantly lower UCP1 and PGC1 levels. The protein lysates were collected 2 h after addition of ligands, which did not affect expression of the non-phosphorylated proteins. Thus, the adipocytes that express myc-KCP have altered cell-autonomous responses to TGF superfamily ligands, consistent with the known role for KCP in modifying the receptor/ligand interactions. That these effects were observed on a ND indicates that they are not due to obesity or associated metabolic syndrome. The cultured cells are also removed from any infiltrating immune cells and associated cytokines, suggesting a direct effect of KCP on TGF-β superfamily signaling in adipocytes.

Animals

All animal use was in compliance with the Institute of Laboratory Animal Research Guide for the Care and Use of Laboratory Animals and approved by the University Committee on Use and Care of Animals at the University of Michigan. The kcp^Tg (31) and kcp^−/− (27) alleles were described previously and were bred onto a C57/Bl6 genetic background. Mice were housed in a specific pathogen-free facility with a 12-h light, 12-h dark cycle and given free access to food and water. The KCP-Tg, KCP-KO, and wild-type males were maintained on a regular diet (5008, Purina LabChow; 16.7% calories from fat) or on a high-fat diet (D12451, Research Diets Inc.; 45% calories from fat) starting at 8 weeks of age for 12–14 weeks.

Glucose tolerance test

Mice were fasted for 6 h then injected i.p. with 0.7g/kg body weight d-glucose. Just before injection, fasting glucose was taken at time 0. With the minimum amount of stress possible, tails were snipped with scissors and gently milked for blood droplets. The first drop was wiped off, and the second drop of blood was collected and read with a glucometer, and the measurement was recorded. Fresh blood droplets were collected every 15 min for 60 min and then every 30 min for another hour.

Metabolic testing

Oxygen consumption (VO₂), carbon dioxide production (VCO₂), spontaneous motor activity, and food intake were measured using the Comprehensive Laboratory Monitoring System (CLAMS, Columbus Instruments), an integrated open-circuit calorimeter equipped with an optical beam activity monitoring device. Mice were weighed each time before the measurements and individually placed into the sealed chambers (7.9 × 4 × 5 inches) with free access to food and water. The study was carried out in a temperature-controlled (5–40 °C) enclosure (CLAMS-ENC, Columbus Instruments) with an operating temperature selected at 22, 30, or 5 °C and lighting set at 12-12 h (6:00 p.m.–6:00 a.m.) dark-light cycles. The measurements were carried out continuously for 72 h. During this time, animals were provided with food and water through the equipped feeding and drinking devices located inside the chamber. The amount of food of each animal was monitored through a precision balance attached below the chamber. The system was routinely calibrated each time before the experiment using a standard gas (20.5% O₂ and 0.5% CO₂ in N₂). VO₂ and VCO₂ in each chamber were sampled sequentially for 5 s in a 20-min interval, and the motor activity was recorded every second in x and z dimensions. The airflow rate through the chambers was adjusted at the level to keep the oxygen differential around 0.3% at resting conditions. Respiratory quotient, also known as respiratory exchange ratio, was calculated as VCO₂/VO₂. Total energy expenditure, carbohydrate oxidation, and fatty acid oxidation were calculated, respectively, using equations based on the values of VO₂ and VCO₂ assuming that the contribution of protein breakdown to energy expenditure under the study condition is negligible and with little variation among the groups (50, 51). For the measurement of non-shivering thermogenesis, mice were kept at a thermoneutral temperature of 30 °C and anesthetized via i.p. injection of 1:2 pentobarbital-saline dilution at 70 mg/kg. After the baseline recording of VO₂ and VCO₂, a single injection of NE (0.5 mg/1 ml) solution was given subcutaneously at a dose of 1 mg/kg. Subsequently, the increases of respiration and energy expenditure were recorded.

Body temperature was measured using a temperature transponder (IPTT-300, Bio Medic Data Systems) that was surgically implanted subcutaneously on the back of the neck in the vicinity of BAT. Mice were briefly anesthetized for less than a minute using an isoflurane vaporizer, and the transponder loaded in the delivering syringe was injected into the subcutaneous space about 1 cm from the injecting site. Mice were replaced back in their home cages and recovered within 5 min. The implantation was done 5 days prior to the CLAMS experiment. During the measurement of VO₂ and VCO₂, temperature was manually recorded using the DAS-7007 (Bio Medic Data Systems) reader scanning from the outside of the CLAMS chamber.

Body fat, lean mass, and free fluid were measured using an NMR analyzer (Minispec LF90II, Bruker Optics). The measurement takes less than 2 min while conscious mice were placed individually into the measuring tube with minimum restraint. The machine was calibrated daily using a reference sample as recommended by the manufacturer.

Antibodies and Western blotting

The following antibodies were purchased from Cell Signaling Technologies: SMAD1 (9743), P-SMAD1 (9511), SMAD3 (9523S), AKT (9272), P-AKT (Ser-473; 4060), cytochrome c oxidase subunit IV (4844), CCAAT/enhancer-binding protein δ (2318), perilipin (9349), PPARγ (2443), and P-ERK1/2 (9101S). Additional antibodies were PGC1α (AB3242, Millipore), UCP1 (U6382, Sigma), myc epitope 9E10 (Sigma), β-tubulin (T4026, Sigma), and P-SMAD3 (ab52903, Abcam).

Tissues were isolated from iBAT and eWAT and homogenized in radioimmune precipitation assay buffer (R0278, Sigma) supplemented with freshly added protease inhibitor mixtures (Roche Diagnostics). Crude lysates were centrifuged at 14,000 × g for 10 min twice, and the protein concentration was measured using the BCA Protein Assay kit (23227, Pierce). Samples were diluted in 6× SDS-PAGE sample buffer, separated on polyacrylamide gels, and transferred to PVDF membranes (IPFL00010, Millipore). Specific proteins were detected with primary antibodies and horseradish peroxidase-conjugated secondary antibodies (GE Healthcare) using Western Lightning enhanced chemiluminescence substrate (Pierce). Blots were scanned and analyzed for band intensities using UN-SCAN-IT version 5.1 software (Silk Scientific, Orem, UT) and confirmed with ImageJ in a blinded fashion. Alternatively, infrared fluorescent secondary antibodies were used for detection and quantification of specific protein on the Odyssey CLx imager (LI-COR Biosciences).

Histology and immunostaining

eWAT fixed in 1% PFA for 1 h at room temperature or overnight in Bouin's fixative. Liver and iBAT were fixed overnight in 4% PFA at 4 °C. After the specific fixation time period for each tissue, samples were processed for paraffin embedding. Picrosirius Red staining was done according to the manufacturer's recommended instructions (24901, Polysciences Inc.).

For immunostaining, fat pads were excised and fixed for 1 h in 1% PFA at room temperature with rocking. Tissues were washed two times in PBS and blocked for 30 min at room temperature with 5% BSA (A7030, Sigma) in PBS with 0.1% saponin (47036, Sigma). Primary and secondary antibodies were diluted in 5% BSA, 0.1% saponin. Samples were incubated for 1 h with primary antibodies at room temperature followed by three washes and incubation with fluorescent conjugated secondary antibodies. After an additional three washes, samples were stored at 4 °C protected from light until imaging. Antibodies used were rabbit anti-caveolin1(610060, BD Transduction Laboratories) and rat anti-galectin-3 (14-5301-85, eBioscience).

RNA analyses

RNA from tissues was extracted using RNeasy Midi kits (Qiagen), and cDNA was generated from 0.5–1.0 μg of total RNA using high-capacity cDNA reverse transcription kits (Applied Biosystems). Power SYBR Green PCR Master Mix (Applied Biosystems) and the StepOnePlus System (Applied Biosystems) were used for real-time quantitative PCR. Acidic ribosomal phosphoprotein expression was used as an internal control for data normalization. Samples were assayed in triplicate, and relative expression was determined using the 2^−ΔΔCT method. Primers pairs were as follows: PGC1, TATGGAGTGACATAGAGTGTGCT and CCACTTCAATCCACCCAGAAAG; KCP, CCACAATGGGCAGTCTTATGG and TGGCACTTCACAGGCACACATC; adiponectin, GCAGGCATCCCAGGACATC and GCGATACATATAAGCGGCTTCT.

Primary preadipocyte isolation and differentiation

Adipocytes were cultured as described previously (52). Mice were sacrificed, and tissue was isolated from iWAT and iBAT depots. Tissue was minced and digested in a collagenase D (1108888201, Roche Applied Science)/Dispase II (4942078, Roche Applied Science) solution. After the tissue was fully digested, cells were resuspended in wash medium (DMEM/F-12 + GlutaMAX; 10565042, Invitrogen) + 10% newborn calf serum (N4762, Sigma)), filtered through a 100-μm cell strainer, and centrifuged at 300 × g for 5 min. The supernatant was removed, and the pellet was disrupted, resuspended in wash media, filtered through a 40-μm cell strainer, and again centrifuged. The resulting pellet was disrupted, resuspended in growth media (DMEM/F-12 + GlutaMAX + 15% FBS (F2442, Sigma), and plated onto 10-cm dishes that had previously been coated with rat tail collagen type 1 (CB-40236, Fisher) following the protocol contained in the product information. Cells were washed after 1 day of growth to remove floating cells and then underwent at least one round of subculture before being seeded onto collagen-coated 12-well plates for differentiation. The day after seeding the cells were stimulated in DMEM/F-12 + GlutaMAX supplemented with 10% FBS, 5 μm dexamethasone (D4902, Sigma), 0.5 μg/ml insulin (15500, Sigma), 0.5 mm isobutylmethylxanthine (17018, Sigma), and 1 μm rosiglitazone (71740, Cayman). After 2 days, cells were maintained in DMEM/F-12 + GlutaMAX with 10% FBS and 0.5 μg/ml insulin. Mature adipocytes were cultured with increasing doses of BMP4 or TGF-β1 (R&D Systems, Inc.) 6–7 days after beginning stimulation, and protein lysates were made 2 h post-stimulation.

Statistical analyses

For quantitative readouts, including body mass, glucose, insulin, body temperature, and quantitative RT-PCR, three to five mice of each genotype were used. For micrographs, specific areas were calculated by ImageJ over eight to 10 images from three animals. For Western blotting, three independent samples were run, and protein levels were measured by densitometry scanning of autoradiographs at appropriate exposures in the linear range. Averages and standard deviations were calculated, and significance was assessed by ANOVA for multiple comparisons or Student's two-tailed t test for independent variables when doing pairwise comparisons with three data points each.