Pharmacological Inhibition of Acid Sphingomyelinase Prevents Uptake of SARS-CoV-2 by Epithelial Cells

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the lead contact, Erich Gulbins (erich.gulbins@uni-due.de).

Materials Availability

This study did not generate new unique reagents.

Data and Code Availability

The published article includes all datasets generated or analyzed during the study.

Human subjects

Human nasal epithelial cells were obtained from 6 healthy volunteers, 4 women and 2 men. Their ages were 20, 21, 43, 48, 54, and 56. We did not observe any differences in infection between cells from women or men. Sample size was planned for the continuous variable difference in viral uptake and was based on two-sided Wilcoxon-Mann-Whitney tests using G∗Power Version 3.1.7, University of Duesseldorf, Germany. Nasal epithelial cells were obtained from all subjects prior and after oral application of amitriptyline and, thus, all subjects were included in both arms (untreated versus treated) of the study.

The experiments were approved by the ethic committee of the University Hospital Essen under the number 20-9348-BO.

Primary cells

We obtained nasal epithelial cells from these volunteers immediately before oral administration of 0.5 mg/kg amitriptyline (Neuraxpharm, Germany) and again 1.5 h and 24 h after administration of amitriptyline. The cells were removed from the nasal mucosa by inserting a small brush into the nose (approximately 1.5-2 cm deep). The brush was gently rotated within the nose. Nasal epithelial cells were released from the brush and suspended immediately in 1 mL HEPES/saline (H/S; 132 mM NaCl, 20 mM HEPES [pH 7.4], 5 mM KCl, 1 mM CaCl₂, 0.7 mM MgCl₂, 0.8 mM MgSO₄) and immediately used for infection.

Cell lines

Vero cells (ATCC CCL-81; monkey kidney epithelial cells) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10 mM HEPES (pH 7.4; Carl Roth GmbH, Karlsruhe, Germany), 2 mM L-glutamine, 1 mM sodium pyruvate, 100 μM nonessential amino acids, 100 U/mL penicillin, 100 μg/mL streptomycin (all from Invitrogen, city, country), and 10% FCS (PAA Laboratories GmbH, Coelbe, Germany).

Caco-2 colon epithelial cells (ATCC HTB-37) were cultured in DMEM supplemented as described above.

Pseudoviral particles

Pseudotyped viral particles based on a replication-deficient VSV that codes for eGFP and firefly luciferase instead of parental VSV-G (VSV∗ΔG-FLuc),³⁹were generated according to a previously published protocol.⁴⁰ At 24 h after transfection by the calcium-phosphate method, HEK293T cells transiently expressing either SARS-2-S or VSV-G were inoculated with VSV-G-trans-complemented VSV∗ΔG-FLuc for 1 h at 37°C and 5% CO₂, after which the inoculum was removed and cells were washed with phosphate-buffered saline (PBS). Finally, the cells were transferred to fresh culture medium and were incubated at 37°C and 5% CO₂. For cells expressing SARS-2-S, the culture medium was supplemented with anti-VSV-G antibody (I1, mouse hybridoma supernatant from American Type Culture Collection [ATCC] CRL-2700) for inactivation of residual VSV-G-trans-complemented VSV∗ΔG-FLuc. At 16 h after inoculation, the culture supernatants were harvested, and cellular debris was pelleted by centrifugation (4,000 × g, 4°C, 10 min). The clarified supernatants were used for the experiments.

Infection of nasal epithelial cells

For infection freshly isolated nasal epithelial cells were pelleted by centrifugation, and resuspended in minimum essential medium (MEM) supplemented with 10% fetal calf serum (FCS) containing pp-VSV-SARS-CoV-2 spike particles. Cells were infected for 60 min, washed in H/S, and cultured for 24 h to allow expression of the eGFP encoded by the particles. Infection was analyzed with a Leica TCS SL confocal microscope (Mannheim, Germany) by counting the percentage of eGFP-positive epithelial cells in at least 500 epithelial cells per sample in randomly chosen microscopic fields.

A further aliquot of the nasal epithelial cells was immediately shock frozen in liquid nitrogen after removal for determination of acid sphingomyelinase activity (see below).

Ex vivo treatment of nasal epithelial cells

Nasal epithelial cells were also obtained from untreated volunteers as described above and were treated with 10 μM amitriptyline (Sigma; # A 8404) dissolved in 0.9% NaCl, anti-ceramide or control antibodies, neutral ceramidase (see below) or left untreated for 60 min ex vivo and then infected with pp-VSV-SARS-CoV-2 spike particles for 60 min. Cells were then washed and further incubated for 24 h to allow expression of eGFP. Infection was analyzed as above.

Infection of Vero lines

Vero cells were grown to subconfluency for 24 h on glass coverslips in a 24-well plate before measurement of the uptake of the pp-VSV-SARS-CoV-2 spike or pp-VSV-G particles. Amitriptyline (5, 10, 20, or 25 μM) was dissolved in 0.9% NaCl and added to the cells 4 h before the addition of pp-VSV-SARS-CoV-2 spike or pp-VSV-G particles. Because amitriptyline binds to serum proteins, we reduced the concentration of FCS in the medium to 1% during the 4 h preincubation period. Controls were also incubated in serum-reduced medium, but without amitriptyline. The medium was then removed, 250 μL of a cell culture supernatant containing pp-VSV-SARS-CoV-2 or pp-VSV-G particles and, if indicated, amitriptyline (5, 10, 20 or 25 μM) was added, and the cells were incubated for 8 h. In addition, we added 2 μg/mL anti-spike (S1) antibody (Sino Biological, #40150-R-007) or 2 μg/mL recombinant ACE2 (Abcam; # ab273687) to the cells 30 min before adding the viral particles. The concentrations were maintained during the infection. We then removed the supernatants, added DMEM medium supplemented as above, and incubated the cells for an additional 12 h to allow expression of eGFP. The medium was removed; cells were washed once in H/S, fixed in 1% paraformaldehyde (PFA) buffered with PBS (pH 7.3) for 10 min, washed, embedded in Mowiol, and analyzed with a Leica TCS-SL confocal microscope equipped with a 40 × lens and Leica LCS software version 2.61. We counted EGFP-positive cells in 2000 cells per sample in randomly chosen microscopic fields. In addition, fixed cells were stained with propidiumiodide (0.5 μg/mL) for 2 min to visualize cells.

Flow cytometry of surface ACE2 as measurement for infection

Cells were cultured in 24-well plates, treated with 25 μM amitriptyline or solvent (0.9% NaCl) for 4 h or left untreated, infected with pp-VSV-SARS-CoV-2, pp-VSV or pp-VSV-G particles, the medium was removed and cells were collected with a cell dissociation buffer (GIBCO; #13151-014). Samples were washed twice in H/S, stained at 4°C for 45 min with 1 μg/mL anti-ACE2 antibodies (1:1000, R&D, #AF933) ceramide antibodies, washed twice in ice-cold H/S, stained with FITC-coupled donkey anti-goat antibodies (1:1000; Jackson Immunoresearch; #705-096-147) for 45 min at 4°C, washed and analyzed by flow cytometry with a BD Calibur.

Infection with SARS-CoV-2

Approximately 10⁶ Caco-2 colon epithelial cells (ATCC HTB-37) were cultured in 6-well plates in DMEM supplemented and pretreated with amitriptyline or were left untreated in DMEM with 1% FCS for 4 h, as described above. Cells were then infected with 1000 plaque-forming units (PFU) of SARS-CoV-2 (isolate Muc-IMB-1, obtained from the Bundeswehr Institute of Microbiology, Munich, Germany) in 1 mL medium for 1.5 h at 37°C, corresponding to a multiplicity of infection (MOI) of 0.001. Cells were then washed with DMEM and further incubated with 2.5 mL DMEM, 1% FCS, and 20 mM HEPES (pH 7.4) containing 10 μM or 25 μM amitriptyline or left untreated. Viral titers in the culture supernatants were determined after 24 h with plaque assays. Studies using RT-qPCR for quantification of the infection followed the same protocol, except that the MOI was increased to 0.1. The primer pairs used for RTqPCR were purchased from Merck: SYBR Green 1, fwd-GCCTCTTCTCGTTCCTCATCAC and rev- AGCAGCATCACCGCCATTG; and SYBR Green 2, fwd- AGCCTCTTCTCGTTCCTCATCAC and rev- CCGCCATTGCCAGCCATTC. The results were reproduced by two independent co-authors of the manuscript.

Neutralization of ceramide

To neutralize ceramide in Vero cells or nasal epithelial cells, we added 50 or 100 μg/mL of the anti-ceramide IgM antibody clone S85-9 (Glycobiotech; MAB_0014) or of a mouse monoclonal anti-ceramide IgG (Antibody Res. Corp.; #111583), or either 0.1 or 0.2 units/mL of neutral ceramidase (R&D, #3557 AH) to the cells, which were then immediately infected with pp-VSV-SARS-CoV-2 spike particles for 60 min. Controls were incubated with irrelevant IgM or IgG antibodies (Dako). Cells were then washed, cultured for 24 h, and analyzed for infection as above.

FITC-Annexin V binding

Cells were treated for 4 h with 10 or 25 μM amitriptyline in DMEM supplemented with 1% FCS as above. Incubation was then continued for 20 h in DMEM containing 10% FCS. Cells were trypsinized, washed in H/S, stained for 15 min with FITC-Annexin V (Roche), and analyzed by flow cytometry. Controls were permeabilized for 5 min with 0.1% Triton X-100 at room temperature before incubation with FITC-Annexin V.

TUNEL studies

Vero cells were treated with 10 or 25 μM amitriptyline as described for FITC-Annexin V staining. Cells were trypsinized, washed with PBS, fixed in 4% PFA buffered in PBS (pH 7.4) for 10 min, washed in PBS, permeabilized with 0.1% Triton X-100 in 0.1% sodium citrate for 5 min at room temperature, and washed. Next, the TUNEL reaction was performed exactly as instructed by the vendor (Roche, #12156792910) using recombinant terminal deoxynucleotidyl transferase (rTdT; EC 2.7.7.31) and tetramethyl rhodamine (TMR) red-labeled nucleotides. Samples were analyzed by flow cytometry. Positive controls were incubated with recombinant micrococcal nuclease or DNase I (3000 U/ml) for 10 min at 22°C before the TUNEL reaction.

Actin staining

Vero cells were grown on glass coverslips, treated with 10 or 25 μM amitriptyline as described above, washed, fixed for 10 min in 1% PFA buffered in PBS (pH 7.3), washed, permeabilized for 5 min with 0.1% Triton X-100 at room temperature, washed and stained with FITC-Phalloidin for 12 h at 4°C. The samples were washed again and embedded in Mowiol. Cells were then analyzed by confocal microscopy on a Leica TCS SL confocal microscope equipped with a 40 × lens and Leica LCS software version 2.61.

Genetic downregulation of sphingomyelinase

The expression of acid or neutral sphingomyelinase in Caco-2 cells was downregulated by transfection with commercial shRNA _targeting acid sphingomyelinase (Santa Cruz Inc.; # sc-41650-SH) or neutral sphingomyelinase (Santa Cruz Inc.; # sc-62655-SH). Cells were transiently transfected by electroporation at 400 V with 5 pulses, 3 msec each, with a BTX electroporator. Control cells were transfected with an irrelevant shRNA (Santa Cruz Inc., # sc-108060). Dead cells were removed by Ficoll gradient centrifugation, and cells were cultured for 36 h before infection with pp-VSV-SARS-CoV-2 spike. Downregulation of acid or neutral sphingomyelinase was confirmed by measuring the activity of the enzyme in transfected, control-transfected, and untransfected cells.

Acid sphingomyelinase activity

To determine acid sphingomyelinase activity, we grew Vero or Caco-2 cells in 24-well plates. Cells were pretreated with amitriptyline for 4 h or transfected as above or were left untreated. The cells were washed in H/S and infected with 250 μL of cell culture supernatant containing pp-VSV-SARS-CoV-2 spike or control pp-VSV particles for 10 to 45 min. Untreated cells were incubated with DMEM that was supplemented as above. Amitriptyline was added at 5 - 25 μM as above. The incubation was terminated by removing the supernatants, and the cells were immediately lysed in 250 mM sodium acetate (pH 5.0) and 1% NP40 for 5 min. The lysates were removed from the plates and diluted to 0.2% NP40 in 250 mM sodium acetate (pH 5.0). Next, we added 0.05 μCi [¹⁴C]sphingomyelin (52 mCi/mmol; Perkin Elmer, #NEC 663010UC) per sample. The substrate [¹⁴C]sphingomyelin was dried for 10 min in a SpeedVac, resuspended in 250 mM sodium acetate (pH 5.0) and 0.1% NP40, and sonicated for 10 min in a bath sonicator before it was added to the samples. The samples were incubated for 30 min at 37°C with shaking at 300 rpm. The enzymatic reaction was terminated by extraction in 4 volumes of CHCl₃:CH₃OH (2:1, v/v), the samples were centrifuged, and an aliquot of the upper aqueous phase was scintillation-counted to determine the release of [¹⁴C]phosphorylcholine from [¹⁴C]sphingomyelin.

To determine the effect of amitriptyline on the activity of the acid sphingomyelinase in nasal epithelial cells, we washed the cells once in H/S after infection. Pellets were immediately shock-frozen, lysed in 250 mM sodium acetate (pH 5.0) and 1% NP40 for 5 min, and processed as above.

Neutral sphingomyelinase activity

Vero cells were infected with pp-VSV-SARS-CoV-2 spike for 5, 10, 20, 30, 45, or 60 min or were left untreated; lysed in a buffer containing 100 mM TrisHCl (pH 7.4), 5 mM MgCl₂, 2.5 mM DTT, 0.2% Triton and 10 μg/ml each of aprotinin and leupeptin; sonicated; and incubated with 0.02 μCi [¹⁴C]sphingomyelin per sample for 30 min at 37°C. Samples were processed as described for acid sphingomyelinase.

Measurement of ceramide

Cells were treated as above with 25 μM amitriptyline for 4 h or left untreated and then washed in H/S. Next, 250 μL of the cell culture supernatant containing pp-VSV-SARS-CoV-2 spike or control pp-VSV or pp-VSV-G particles was added as above for a period of 10 to 45 min. Amitriptyline (25 μM) was immediately added again after the addition of the pseudoviral particles. Untreated cells were incubated with DMEM supplemented as above. The medium was removed, and cells were lysed in 200 μL H₂O, scraped from the plates, and extracted in CHCl₃:CH₃OH:1N HCl (100:100:1, v/v/v). Samples were centrifuged for 5 min at 14,000 rpm. The lower phase was collected, dried, and resuspended in 20 μL of a detergent solution (7.5% [w/v] n-octyl glucopyranoside, 5 mM cardiolipin in 1 mM diethylenetriaminepentaacetic acid [DTPA]). Micelles were obtained by bath sonication for 10 min and used for the kinase reaction, which was initiated by adding 70 μL of a reaction mixture containing 10 μL diacylglycerol (DAG) kinase (GE Healthcare Europe, Munich, Germany), 0.1 M imidazole/HCl (pH 6.6), 0.2 mM DTPA (pH 6.6), 70 mM NaCl, 17 mM MgCl₂, 1.4 mM ethylene glycol tetraacetic acid, 2 mM dithiothreitol, 1 μM adenosine triphosphate (ATP), and 5 μCi [³²P]γATP (6000 Ci/mmol; Hartmann Radiochemicals, Braunschweig, Germany). The kinase reaction was performed for 60 min at room temperature with 300 rpm shaking and was terminated by the addition of 1 mL CHCl₃:CH₃OH:1N HCl (100:100:1, v/v/v), 170 μL buffered saline solution (135 mM NaCl, 1.5 mM CaCl₂, 0.5 mM MgCl₂, 5.6 mM glucose, 10 mM HEPES [pH 7.2]), and 30 μL of a 100 mM EDTA solution. Phases were separated, and the lower phase was collected. The samples were then dried in a SpeedVac, separated on Silica G60 thin-layer chromatography (TLC) plates with chloroform/acetone/methanol/acetic acid/H₂O (50:20:15:10:5, v/v/v/v/v), and developed with a Fuji phosphoimager. Ceramide amounts were determined by comparison with a standard curve using C16 to C24 ceramides as substrates.

Other antidepressants

To test the effects of other antidepressants on the infection of Vero cells with pp-VSV-SARS-CoV-2 spike or pp-VSV-G, we treated Vero cells for 4 h with 10 or 20 μM imipramine (Sigma-Aldrich; # I 0899), 10 or 20 μM desipramine (Sigma-Aldrich, # D 3900), 5 μM sertraline (Sigma-Aldrich; # S 6319), 10 or 20 μM escitalopram (Sigma-Aldrich; # E 4786), 10 or 20 μM maprotiline (Sigma-Aldrich; # M 9651) or 25 or 35 μM fluoxetine (Sigma-Aldrich; # 56296-78-7). Amitriptyline, desipramine and imipramine, were dissolved in 0.9% NaCl, all other antidepressants in DMSO with a final concentration of 0.1% DMSO. Controls were 0.9% NaCl or 0.1% DMSO. We then determined the activity of acid sphingomyelinase or infected the cells with pp-VSV-SARS-CoV-2 spike or pp-VSV-G particles for 24 h and then determined the expression of eGFP or the expression of ACE2 on the cell surface as measurements for infection as above.

Ceramide reconstitution

Cells were treated with 10 or 20 μM amitriptyline, 10 or 20 μM imipramine, 10 or 20 μM desipramine, 5 μM sertraline, 10 or 20 μM escitalopram, or 10 or 20 μM maprotiline or 25 or 35 μM fluoxetine for 4 h or transfected with shRNA _targeting the acid sphingomyelinase as above and infected with pp-VSV-SARS-CoV-2 spike, after which 10 μM C16 ceramide (Avanti Polar Lipids; # 860516) or 0.2 U/mL recombinant acid sphingomyelinase (specific activity: 1700 pmol/min/μg; R&D, #5348-PD-010) was immediately added. C16 ceramide was resuspended in cell culture medium and sonicated for 10 min in a bath sonicator before use. We then determined viral uptake as above.

Flow cytometry of surface ceramide

Vero cells were cultured in 24-well plates, treated with 25 μM amitriptyline or solvent (0.9% NaCl) for 4 h as above, each 2 μg/mL recombinant ACE2 or anti-spike antibodies or left untreated, and infected with pp-VSV-SARS-CoV-2, pp-VSV or pp-VSV-G particles for 30 min. The cells were collected with a cell dissociation buffer (GIBCO; #13151-014), washed twice in H/S, stained at 4°C for 45 min with 1 μg/mL anti-ceramide antibodies, clone S85-9, washed twice in ice-cold H/S, stained with Cy3-coupled donkey anti-mouse IgM F(ab)₂ fragments (1:1000; Jackson Immunoresearch; #715-166-020) for 45 min at 4°C, washed and analyzed by flow cytometry with a BD Calibur.