Amino Acid Transport and Metabolism in Mycobacteria: Cloning, Interruption, and Characterization of an l-Arginine/γ-Aminobutyric Acid Permease in Mycobacterium bovis BCG

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are described in Table 1. Escherichia coli strains were grown in Luria-Bertani medium, and mycobacterial strains were grown in Middlebrook medium [per liter, (NH₄)SO₄, 0.5 g; l-glutamic acid, 0.5 g; sodium citrate, 0.1 g; pyridoxine, 0.001 g; biotin, 0.0005 g; Na₂HPO₄, 2.5 g; KH₂PO₄, 1.0 g; ferric ammonium citrate, 0.04 g; MgSO₄, 0.05 g; CaCl₂, 0.0005; ZnSO₄, 0.001; CuSO₄, 0.001 g]. Middlebrook 7H9 (liquid) and 7H11 (1.5% agar) media (Difco) were supplemented with glycerol (0.5% vol/vol) and ADC supplement (0.5% bovine serum albumin, fraction V [Boehringer Mannheim], 0.2% dextrose, 0.85% NaCl). Antibiotics were added at the following concentrations: ampicillin, 100 μg/ml, kanamycin and streptomycin, 50 μg/ml for E. coli and 20 μg/ml for BCG; and hygromycin, 150 μg/ml for E. coli and 50 μg/ml for BCG. The minimal medium used was composed of basal salts (0.1% KH₂PO₄, 0.25% NaH₂PO₄, 0.5% NH₄Cl, 0.2% K₂SO₄) medium supplemented with glycerol (0.5%). Sauton's medium was used without amino acid supplements (17). Where applicable, the nitrogen (NH₄Cl) and/or carbon (glycerol and/or dextrose) sources were omitted. All liquid cultures of BCG were supplemented with 0.05% Tween 80 (Sigma Chemicals).

Cloning and DNA manipulations.

Plasmid DNA preparations, restriction endonuclease digestions, alkaline phosphatase treatments, ligations, transformations, and other DNA manipulations were performed by standard procedures (36). For electroporation of BCG, the cells were grown until the culture reached a turbidity (optical density at 600 nm [OD₆₀₀]) of about 0.6 and then harvested at 4,000 × g for 10 min. The pellet was washed with 10% glycerol and centrifuged again at 4,000 × g for 10 min. The procedure was repeated two more times before resuspension of the pellet in 1/10 volume of 10% glycerol. All manipulations were carried out at 37°C. DNA (3 to 5 μg) was added to 0.5 ml of cells in a 0.4-cm electroporation cuvette (BTX). The cuvette was subjected to a single pulse using the Bio-Rad Gene Pulser set at 2.5 kV and 25 μF, with the pulse controller resistance set at 1,000. The contents of the cuvette were diluted into 5 ml of 7H9 medium and incubated overnight at 37°C. After incubation, the entire 5 ml was centrifuged and plated onto 7H10-antibiotic plates. Transformants appeared after incubation at 37°C for 3 to 4 weeks.

Construction of BCG Rv052 deletion strain.

PCR analysis to screen the BCG genomic library to isolate a cosmid containing the B. subtilis rocE homolog was performed using the PCR kit from Boehringer Mannheim Biochemicals. The primers used were 5′ ATCGTGATCTTCTTCGTCGG 3′ and 5′ ATGATCACGCACAGGAATCC 3′. The cosmid DNA was digested with a number of restrictions enzymes, and a Southern analysis using the PCR product as a probe revealed the presence of a 6-kb EcoRI fragment bearing the homolog. This fragment was then subcloned into pGEM3Zf− and is called pAS5 (see Fig. 1). This was then transformed into a dam E. coli strain, GM48. Transformation into GM48 permitted digestion with the enzyme BclI, which released a 191-bp fragment. A Kan-Str cassette as a BamHI fragment from plasmid pSM240 was then inserted into the BclI site of pAS5 to create pAS6. This construct was then used for allelic exchange of the homolog, the Rv052 gene in BCG.

PCR and Southern analysis were used to differentiate between single- and double-crossover events (see Fig. 1). BCG genomic DNA was isolated using N-acetyl-N,N,N-trimethylammonium bromide) (Sigma) as previously described (18). PCR was performed using the Expand Long Template Kit (Boehringer Mannheim) as specified by the manufacturer. The primers 5′ AGCCACATCCGTACCCCCAG 3′ and 5′ CACGCATCGTGATCTTCTTCG 3′ flank the Kan-Str cassette such that single crossovers would show fragments of 471 bp of the wild-type copy of the gene and the 3.5-kb fragment containing the Kan-Str marker. True allele replacements would lack the small band (deleted by recombination out of the genome) and would show only the 3.5-kb fragment. The PCR results were confirmed by Southern analysis of the double recombinant with the Kan-Str marker as a probe. Southern hybridization was performed by the method of Maniatis et al. (36). The Southern analysis also shows that the Kan-Str cassette inserted only once in the genome.

Uptake assays.

Cells were grown to mid-log phase, washed three times with basal salts medium plus Tween 80 at 0.05%, and concentrated in basal salts medium approximately fivefold to a final OD₆₀₀ of 3.0. The cell suspensions (1 ml) were warmed to 37°C with shaking. The culture was treated with rifampin (200 μg/ml) for 10 min prior to initiation of an uptake assay to block transcription and subsequently protein synthesis; this prevented the unlimited incorporation of radiolabeled amino acids into protein. The uptake reaction was initiated by the addition of radiolabeled substrate plus unlabeled substrate at the specific activities (usually 40 to 50 μCi/μmol) and to the final concentrations (usually 100 μM) described in the legends of the figures. Incorporation was terminated by removal of 0.1-ml samples at the indicated time to filters (Whatman GF/F; 0.45 μm) prewetted with BS medium. The cells were rinsed quickly (within 10 to 15 s) three times with 7 ml of ice-cold basal salts medium plus Tween 80 on a Hoeffer 10-place manifold with air vacuum. Filters with cells thereon were transferred to vials containing 5 ml of scintillation fluid for determination of radioactivity. The counts per minute were normalized to milligrams of protein per 0.1-ml aliquot for each cell suspension; protein was determined by the Bio-Rad protein assay.

For analysis of uptake by cells resuspended in different media, care was taken to ensure that the cultures used for uptake studies were at similar densities before the washing and concentration steps. This was essential when cells were resuspended in a medium that does not support measurable growth (minimal salts plus amino acid or γ-aminobutyric acid [GABA]) and compared with cells resuspended in Middlebrook medium.

To measure the effect of exogenous l-arginine on [³H]uracil incorporation, 0.5 μCi of [³H]uracil (38.5 Ci/mmol) (New England Nuclear) and peptide were added simultaneously to the cells to initiate the experiment. After 16 h, the cultures were precipitated in 10% trichloroacetic acid (TCA) (Sigma) at 4°C for 20 min, filtered, and washed three times with 5 ml of cold 10% TCA over filters (Whatman GF/F; 0.45-μm pore size) prewetted with 10% TCA on a Hoeffer 10-place manifold with air vacuum (as above).

Macrophage survival assays.

J774.1 cells were maintained in Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal calf serum (Sigma), amino acids (BioWhittaker), and l-glutamine (Sigma). The cells were subcultured into 96-well plates (1.5 × 10⁵ cells per well) for 6 to 12 h. Then 2 × 10⁶ CFU of logarithmically growing bacteria were washed in macrophage medium and placed in the wells. After 4 to 6 h of attachment, the wells were rinsed three times in macrophage medium. The numbers of intracellular bacteria was determined by removing the supernatant of three wells in parallel, lysing the macrophages in double-distilled H₂O ddH₂O, diluting, and plating for CFU on 7H11 plates with the appropriate antibiotics. The supernatants were checked for the presence of extracellular bacteria at every time point, and the number of extracellular bacteria remained in the range of 1 to 5% of that of intracellular organisms. Triplicate determinations were made for each time point, and the experiment was performed five times.

Cloning and interruption of the rocE permease homolog from BCG.

The rocE gene of B. subtilis encodes a major l-arginine permease. Its expression is induced by l-arginine in the medium, controlled at the level of transcription by the product of the rocR gene, a member of the NtrC/NifA family of regulators. Using the amino acid sequence of the B. subtilis rocE gene, the Sanger TB database was analyzed for ORFs with homology to the rocE gene. The strongest homology was exhibited by Rv0522 (31% identity and 53% similarity). The sequence of this predicted ORF in turn shows 44.3% identity to the GABA permease gene (gabP) of E. coli and 20% identity to gabP of B. subtilis. In B. subtilis, the rocE gene is part of the rocDEF operon bearing the genes for l-arginine catabolism. In contrast, Rv0522 is not part of an operon and is flanked by divergent ORFs of unknown function.

Primers derived from the Sanger database (16) were used to screen a genomic library of BCG (Pasteur) DNA in pYUB18 (27) for the presence of Rv0522 sequences. A cosmid carrying the BCG homolog of Rv0522 was identified (Fig. 1). From this cosmid, an EcoRI fragment of 6 kb bearing the BCG Rv0522 homolog was cloned into pGEM3Zf to create pAS5 (Table 1). A 191-bp BclI fragment in the ORF was removed and replaced with an antibiotic cassette containing kanamycin and streptomycin resistance markers to create pAS6. This final construct was linearized with BamHI and electroporated into BCG. Transformants resistant to both kanamycin and streptomycin were selected. The candidates for allele replacements were first screened by PCR, using oligonucleotide primers flanking the marker insertion site (see Materials and Methods). Southern blot analysis confirmed the structure of genomic DNA representing the wild-type strain and the allele replacement (double crossover) strain, AS1 (Fig. 1).

To complement the deletion, a wild-type copy of the Rv0522 gene was inserted in single copy into AS1. The mycobacteriophage L5 attachment site (attB) was used for integration of pAS7, the pMV305 plasmid carrying the attP site of L5 (32) and a wild-type copy of the BCG Rv0522 gene. The complemented mutant strain was named AS2.

Uptake properties of AS1 (ΔRv0522).

AS1 and its wild-type parent were analyzed for uptake of various l-amino acids by using radiolabelled substrates. The cells were grown in Middlebrook medium (7H9 plus glycerol, ADC supplement, and 0.05% Tween). The mutant strain showed a significant decrease in uptake of l-[¹⁴C]arginine (90% reduction) (Fig. 2A). In addition, the mutant showed a clear defect (75% reduction) in uptake of [¹⁴C]GABA compared with wild-type cells (Fig. 2B). Neither l-[¹⁴C]arginine nor [¹⁴C]GABA uptake was completely abolished. This was not unexpected, as most bacteria have multiple transporters for l-arginine. There was no difference between the wild type and mutant in uptake of the structurally related amino acids l-[¹⁴C]ornithine (Fig. 2C) or l-[¹⁴C]lysine (Fig. 2D). The complemented mutant strain, AS2, contained a wild-type copy of the Rv0522 gene supplied in trans that fully complemented the l-[¹⁴C]arginine (Fig. 2A) and [¹⁴C]GABA (data not shown) uptake defects. Comparison of the uptake of structurally unrelated amino acids, l-alanine and l-proline, indicated that there were no differences between the wild-type and AS1 strains (data not shown). Finally, the apparent K_ms for transport of l-[¹⁴C]arginine and [¹⁴C]GABA were calculated from Lineweaver-Burk analyses (Fig. 3) and found to be 250 and 165 μM, respectively.

l-[¹⁴C]arginine uptake by wild-type BCG and AS1.

In other bacteria, expression of l-arginine catabolic and biosynthetic operons is regulated by the presence or absence of exogenous l-arginine (7, 13, 23, 53). This regulation is often mediated by l-arginine acting as a corepressor in concert with the ArgR/AhrC protein as a repressor (34). To examine the effect of exogenous l-arginine on uptake of l-[¹⁴C]arginine in wild-type BCG, cells in balanced growth in Middlebrook medium were washed and incubated in minimal salts medium (see Materials and Methods) with 20 mM l-arginine as the sole carbon and nitrogen source. After 24 h at 37°C, uptake of l-[¹⁴C]arginine by cells incubated in l-arginine alone was only slightly reduced (25%) in comparison to that by wild-type cells growing in Middlebrook medium (Fig. 4A). The effect of starvation for carbon and nitrogen on l-[¹⁴C]arginine uptake by wild-type BCG was also examined. After 2 h (data not shown) or 24 h (Fig. 4A) of starvation in basal salts lacking sources of carbon and nitrogen, l-[¹⁴C]arginine uptake by wild-type cells was unchanged.

Mid-log-phase AS1 cells were washed and incubated for 2 h (data not shown) or 24 h in minimal salts with 20 mM arginine. Figure 4B shows that in contrast to the reduction seen in wild-type BCG, l-[¹⁴C]arginine uptake by the AS1 mutant was strongly increased over the levels found in AS1 grown in 7H9 medium. The results were the same after 2 h in 20 mM arginine. This suggests that exogenous l-arginine in the medium may induce a permease other than that encoded by Rv0522.

Uptake of l-[¹⁴C]arginine by starved AS1 cells was also measured (Fig. 4B). Surprisingly, under these conditions, the mutant strain showed levels of uptake higher than under any other conditions, including those exhibited by the wild type after growth on Middlebrook medium.

[¹⁴C]GABA uptake by wild-type BCG and AS1.

To examine the effect of exogenous GABA on [¹⁴C]GABA uptake in BCG, wild-type cells in balanced growth in Middlebrook medium and cells washed and incubated in minimal salts medium with 20 mM GABA as the sole carbon and nitrogen source were compared. Figure 5A shows that there was a 70% reduction in [¹⁴C]GABA uptake by wild-type cells after exposure to 20 mM GABA. The results were identical after only 2 h of incubation in 20 mM GABA (data not shown).

The relative contribution of the Rv0522 permease to this reduction in GABA uptake was evaluated by measuring the effect of GABA exposure on [¹⁴C]GABA uptake by AS1 cells. Figure 5B shows that uptake of [¹⁴C]GABA was reduced 60% in AS1 after 24 h of incubation in 20 mM GABA, in comparison with mutant cells in Middlebrook medium.

Cultures growing in Middlebrook medium were washed and incubated in minimal salts with no carbon or nitrogen source. The effects of this starvation on [¹⁴C]GABA uptake by wild-type BCG were evaluated and shown in Fig. 5A. There was a 70% reduction in uptake of [¹⁴C]GABA by wild-type cells after starvation, similar to that exhibited by wild-type cells after GABA exposure. AS1 cells also showed a reduction comparable to that exhibited after GABA exposure (Fig. 5B). Thus, unlike GABA uptake in B. subtilis (21), GABA uptake by wild-type BCG was not induced by starvation for carbon and nitrogen, and was, in fact, slightly repressed. Furthermore, the reduction shown in [¹⁴C]GABA uptake by AS1 suggested that a wild-type uptake activity not affected by the deletion of Rv0522 was responsive to carbon and nitrogen starvation.

l-Arginine utilization by BCG.

Growth of wild-type BCG and AS1 cells in minimal arginine medium was measured. The cells were first grown to the mid-logarithmic growth phase in standard Middlebrook medium. They were washed and resuspended at an OD₆₀₀ of 0.2 in various minimal media (basal salts medium or Sauton's medium [see Materials and Methods]) containing at 1 or 20 mM l-arginine as the sole carbon and/or sole nitrogen source. Surprisingly, neither wild-type nor mutant cells were capable of growing in either medium with l-arginine as the sole carbon or nitrogen source. In basal salts medium or Sauton's medium supplemented with glycerol (0.5%) and ammonium chloride (0.5%), wild-type cells grew at rates comparable to those seen for Middlebrook 7H9-grown cells. The following amino acids were tested as sources of either carbon or nitrogen to support the growth of wild-type BCG: l-histidine, l-lysine, l-ornithine, GABA, l-alanine, and l-proline. In all cases, single amino acids were incapable of supporting growth. This is in marked contrast to the observation that a wide range of amino acids and di- and tripeptides at a concentration of 2 to 5 mM are capable of supporting the growth of wild-type M. smegmatis in minimal medium as either the sole carbon or nitrogen source (9, 45).

Effect of exogenous arginine on wild-type BCG.

Wild-type BCG was grown in Middlebrook 7H9 medium, containing glycerol and ammonium, in the presence of exogenous l-arginine at concentrations ranging from 0 to 40 mM (Fig. 6). Note that in this experiment, the primary sources of carbon and nitrogen (glycerol and ammonium, respectively) provided by Middlebrook medium are optimal for growth of the slow-growing mycobacteria (45). Surprisingly, at 15 mM arginine, there was some inhibition of growth, and at 20 mM, growth was completely inhibited. Structurally related amino substrates, such as l-ornithine (Fig. 6), l-lysine (results not shown), and GABA (results not shown), and unrelated amino acids (l-proline and l-alanine [results not shown]) at the same concentrations showed no inhibition of growth; therefore, this growth inhibition was specific for arginine. Furthermore, growth inhibition by l-arginine was reduced in AS1 (Fig. 6), as would be predicted from the reduced arginine transport in AS1 cells (Fig. 3A).

Amino acids can also be supplied to cells in the form of peptides. Indeed, Marquis et al. showed that in culture, threonine auxotrophs of Listeria monocytogenes grow poorly on free threonine and quite well on threonine-containing peptides. These same auxotrophs showed no difference in growth rate within threonine-starved J774 macrophages, suggesting that threonine-containing peptides are available for intracytoplasmic growth (39). In BCG, there is no toxicity of exogenous l-arginine when supplied at 20 or 30 mM in the form of l-arginyl-l-glutamate or l-arginyl-l-asparagine (data not shown).

High concentrations of exogenous l-arginine are cytocidal.

To determine whether the effect of exogenous arginine on the growth of wild-type BCG is cytostatic or cytocidal, the cultures described in Fig. 6 were plated to determine CFUs. There was no effect of 10 mM arginine on viability, but the culture containing 20 mM arginine contained no viable cells (data not shown). To confirm this observation, a labeling assay (14) was used to evaluate the metabolic activity of wild-type BCG exposed to exogenous arginine. [³H]uracil incorporation into precipitable macromolecules was inhibited by 50% in wild-type BCG growing in rich medium and incubated in 20 mM l-arginine for 24 h (data not shown). In contrast, the addition of 20 mM l-arginine to BCG resuspended in basal salts medium (starvation conditions) had little effect (10% inhibition) on [³H]uracil incorporation. Thus, the effect of exogenous l-arginine on [³H]uracil incorporation appears to depend on the nutritional state of the culture.

Survival of strain AS1 in cultured murine macrophages.

Roles for genes involved in l-arginine transport (30) and metabolism (35) have been implicated in macrophage infection studies (see Discussion). Wild-type BCG, AS1, and AS2 were evaluated for survival in unactivated J774.1 macrophages. No differences were found among the three strains.