Next Article in Journal
Different Brain Phenotypes in Magnetic Resonance Imaging of Healthy Children after Prenatal Insults
Next Article in Special Issue
High Plasma Levels of Neopterin Are Associated with Increased Mortality among Children with Severe Malaria in Benin
Previous Article in Journal
Bile Acids in Intrahepatic Cholestasis of Pregnancy
Previous Article in Special Issue
Comparative Assessment of the Sensitivity of Ten Commercial Rapid Diagnostic Test Kits for the Detection of Plasmodium
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France

by
Marylin Madamet
1,2,3,4,
Rémy Amalvict
1,2,3,4,
Nicolas Benoit
1,2,3,4,
French National Reference Centre for Imported Malaria Study Group
and
Bruno Pradines
1,2,3,4,*
1
Unité Parasitologie et Entomologie, Département de Microbiologie et Maladies Infectieuses, Institut de Recherche Biomédicale des Armées, 13005 Marseille, France
2
Aix Marseille Univ, IRD, AP-HM, SSA, VITROME, 13005 Marseille, France
3
IHU Méditerranée Infection, 13005 Marseille, France
4
Centre National de Référence du Paludisme, 13005 Marseille, France
*
Author to whom correspondence should be addressed.
The members are listed in Acknowledgments.
Diagnostics 2022, 12(11), 2747; https://doi.org/10.3390/diagnostics12112747
Submission received: 9 October 2022 / Revised: 3 November 2022 / Accepted: 7 November 2022 / Published: 10 November 2022
(This article belongs to the Special Issue Diagnosis and Management of Malaria)

Abstract

:
Malaria is the most common human parasitic disease in the world with the highest morbidity and mortality. Due to the severity of malaria caused by Plasmodium falciparum and the urgency of therapeutic management, quick and reliable diagnosis is required for early detection. Blood smear microscopy remains the gold standard for malaria diagnosis. Molecular diagnosis techniques are the most sensitive and specific in cases of low parasitaemia and in the detection of mixed infections. The purpose of this study was to evaluate a new commercial test involving the molecular diagnostic technique to detect the five human Plasmodium species. The Vitassay qPCR Malaria 5 test is based on the multiplex real-time PCR of a conserved _target region of the 18S rRNA gene for the five human Plasmodium species. A total of 190 samples collected from imported cases of malaria were diagnosed using this test and compared against a homemade reference real-time PCR. The sensitivities of the Vitassay qPCR Malaria 5 test for all Plasmodium species ranged from 93.8% to 100% and specificity ranged from 97.7% to 100%. Based on these criteria, this test is recommended for the diagnosis of the human Plasmodium species.

1. Introduction

Malaria is one of the most severe public health problems worldwide, causing an estimated 241 million clinical cases and leading to 627,000 deaths in 2020 [1]. According to the World Health Organization (WHO), the African continent is the most impacted by malaria infection, accounting for 95% of deaths worldwide, mostly in young children.
France is the non-endemic European country most affected by imported cases of malaria. The French National Reference Centre for Malaria (Malaria CNR) is charged with the epidemiologic surveillance of imported malaria cases in France [2]. Some 2185 imported malaria cases were reported by the network of biological and clinical correspondents to the French Malaria CNR in 2021, and it has been estimated that there are 4995 cases for the whole of France (personal data, French Malaria CNR). The most commonly detected species in 2021 was Plasmodium falciparum (88.5%). It is imperative that the Malaria CNR has the most efficient diagnostic tools. Effective diagnostic techniques could enable the early diagnosis of malaria, and prevent infection from progressing to severe malaria or death. Diagnosis should be performed within four hours of the sample’s arrival in metropolitan France [3]. As recommended by the WHO, the gold standard for malaria diagnosis is based on the microscopic observation of asexual stages of the parasite (thin blood films and thick blood smears), which is the only method recommended in France, and rapid diagnostic tests (RDTs) for malaria, based on immunochromatographic techniques, are routinely used for diagnosis in the Malaria CNR. However, in cases of low parasitaemia and mixed infections, microscopic diagnosis is sometimes difficult. RDTs also lack the ability to detect low parasitaemia and species other than P. falciparum [4,5]. Moreover, many false-negative results have been reported with P. falciparum histidine-rich protein 2 (PfHRP2)-based RDTs, due to parasites lacking the pfhrp2 gene [6]. Over the last three decades, molecular biology has been developed as a highly sensitive and specific complementary diagnostic method [3]. A homemade real-time PCR is commonly used by the Malaria CNR in Marseille [7]. Currently, very few different qPCR malaria tests are commercially available. Most of them are designed to identify only the Plasmodium genus or the four human Plasmodium species (P. falciparum, P. vivax, P. malariae, and P. ovale). It is essential to select the most efficient kit depending on test performance (sensitivity and specificity) and operating constraints (storage conditions and ease of use).
The aim of this study was to evaluate the sensitivity and specificity of the Vitassay qPCR Malaria 5 test, based on the real-time PCR of the 18S rRNA plasmodial gene. A thin blood smear, the gold-standard method, and a homemade real-time PCR were used as references.

2. Materials and Methods

2.1. Collection of Plasmodium Isolates

The samples were taken from malaria cases imported from endemic countries in patients hospitalised in French civilian or military hospitals and sent to the Malaria CNR (Institut de Recherche Biomédicale des Armées, IHU Méditerranée Infection, Marseille).
Ninety samples isolated between 2019 and 2020 were assessed in this study (Table 1) and retrospectively selected for characteristics such as low parasitaemia, species other than P. falciparum, and mixed infections, as well as 100 complementary isolates collected between 2021 and 2022 without selection.

2.2. Microscopic Technique

Plasmodium infection samples were identified from thin blood smears stained with eosin and methylene blue using a RAL® kit (RAL Reagents, Paris, France) by well-trained and experienced technicians. The parasitaemia percentage was estimated by counting the number of infected cells as a percentage of the red blood cells.

2.3. Reference Real-Time PCR

The reference molecular diagnosis was performed by real-time PCR using a Light Cycler 2.0 (Roche Group, Rotkreuz, Switzerland) to identify four human Plasmodium species (with the exception of P. knowlewsi), as previously described [7]. The primers and probes used were presented in Table 2. Briefly, DNA was extracted from 200 µL of whole blood using the QIAamp® DNA Blood Mini kit, according to the manufacturer’s recommendations (Qiagen, Hilden, Germany). Each parasite species was detected by an individual real-time PCR _targeting a specific gene for each of the four human Plasmodium species using the Light Cycler® TaqMan® Master Mix (Roche Group, Switzerland). For each PCR run, two negative controls (ultra-pure water and human DNA) and one positive control (specific DNA from each species) were used.
Homemade real-time PCR tests, _targeting the 18S rRNA gene, were performed to differentiate P. ovale wallikeri from P. ovale curtisi using Plasmo1_F (5′ GTTAAGGGAGTGAAGACGATCAGA 3′) and Plasmo2_R (5′ AACCCAAAGACTTTGATTTCTCATAA 3′) primers, as previously described [8].

2.4. Vitassay qPCR Malaria 5 Test

The Vitassay qPCR Malaria 5 test is a ready-to-use multiplex PCR that can be used with the CFX96™ Real-Time PCR Detection System (Bio-Rad, Marnes-la-Coquette, France), according to the manufacturer’s recommendations (Servibio, Courtaboeuf, France). DNA was extracted from 200 µL of whole blood using an extraction control (EC). This test contains, in each well, all the necessary real-time PCR reagents to amplify a conserved _target region of the 18S rRNA gene for the five human Plasmodium species. The first low-profile strip contains the multiplex reaction mix for the detection of P. malariae, P. knowlesi, and/or P. ovale, while the second contains the mix for the detection of P. falciparum and/or P. vivax. Each plasmodial species was simultaneously detected by distinct fluorescence channels: P. malariae and P. falciparum DNA _targets in the FAM channel, P. knowlesi and P. vivax DNA _targets in the ROX channel, and P. ovale DNA _targets in the Cy5 channel, and the EC DNA _target is amplified and detected in the HEX channel. For each PCR run, the EC, a negative control (human DNA), and a positive control (specific DNA from each species) were included. The EC allows the detection of a problem of extraction of a poor-quality and/or a shoddy reaction due to inhibitor presence.

2.5. Analysis of the Results

The aim of analysing the results was to compare the ability of the Vitassay qPCR Malaria 5 kit to detect each Plasmodium species infection against the reference homemade real-time PCR results. Diagnostic performances such as sensitivity and specificity were evaluated using the following formula (TP = the number of true positives, FN = false negatives, FP = false positives, and TN = true negatives):
Sensitivity = TP/(TP + FN), (proportion of samples for which the malaria species was correctly identified)
Specificity = TN/(FP + TN), (proportion of samples for which the malaria species was not correctly identified)
For statistical analysis, the Fisher Student’s t test was used appropriately, p-values were evaluated, and statistical significance was set at p-values < 0.05.

3. Results

All the samples were detected by thin blood smears and confirmed by real-time PCR.
A total of 190 samples were assessed, and 187 isolates were found to be positive by microscopy with parasitaemia ranging from <0.001% to 33%. A total of 147 isolates were identified as P. falciparum (parasitaemia between <0.001% and 33%) by homemade real-time PCR, 5 as P. vivax (parasitaemia between <0.001% and 0.6%), 11 as P. malariae (parasitemia between <0.001% and 0.2%), 16 as P. ovale (parasitemia between <0.001% and 0.15%), 8 as mixed infections (4 as P. falciparum/P. malaria, 3 as P. falciparum/P. ovale, and 1 as P. falciparum/P. malaria/P. ovale), and 3 as negative samples (Table 1). Among the sample identified as P. ovale, 13 were P. ovale curtisi and 7 were P. ovale wallikeri.
Between the commercial molecular diagnostic test (Vitassay qPCR Malaria 5) and the homemade reference real-time PCR, only three discrepant diagnoses were observed. One case was due to P. falciparum and the two others were mixed infections (Table 3).
The 187 other diagnoses showed no significant difference in terms of the specific detection of the four human Plasmodium species (P. falciparum, P. vivax, P. malariae, and P. ovale). Samples with low parasitaemia (n = 28/190, <0.001%) were correctly detected. Overall, mixed infections with P. falciparum and non-falciparum species were distinctly diagnosed. The two species of P. ovale, wallikeri, and curtisi were successfully identified.
Using the Vitassay qPCR Malaria 5 test, the sensitivities for each respective malaria species were 99.4% for P. falciparum, 100% for P. vivax, 100% for P. ovale, and 93.8% for P. malariae, while the respective specificities were 97.7% for P. falciparum, 100% for P. vivax, 99.4% for P. ovale, and 100% for P. malariae (Table 4).
The variability of the Ct values was normal between the two PCR methods, due to the intrinsic variability of the molecular diagnosis (thermal cycler and reaction mixture) and the specific _target detected. However, the Ct value results between the two real-time PCR techniques were concordant with Pearson’s correlation coefficient (r) of 0.984 and a p-value of 9.8 × 10−91) (Figure 1).
The Ct values of EC included in each reaction were constant, which made it possible to validate the performance and reproducibility of the Vitassay qPCR Malaria 5 test.
The diagnostic performance between the Vitassay qPCR Malaria 5 test and the reference homemade real-time PCR was compared in 190 clinical samples using a Fisher’s exact test. There was no significant difference between the two assays (p-value = 1).
These results show the high sensitivity and specificity for detecting Plasmodium spp. using the Vitassay qPCR Malaria 5 molecular diagnostic test.

4. Discussion

The severity of malaria due to P. falciparum requires early therapeutic management involving rapid and effective diagnosis. Although diagnosis by microscopy remains the gold standard for malaria identification, molecular techniques can detect low parasitaemia and mixed infections and consequently avoid misdiagnosis. A new commercial molecular diagnostic kit was therefore evaluated: the Vitassay qPCR Malaria 5 test.
The Vitassay qPCR Malaria 5 test makes it possible to detect and differentiate P. falciparum, P. vivax, P. ovale, P. malariae, and/or P. knowlesi using multiplex real-time PCR on clinical samples. According to the supplier, this molecular diagnostic tool has a detection limit of ≥10 copies of DNA per reaction. We evaluated the limit of detection (LOD) of the Vitassay qPCR Malaria 5 test for P. falciparum by multiple dilutions of an isolate. This LOD was estimated at a parasitaemia value equivalent to 0.000001%, while the LOD of the microscopy was estimated at 0.001% (>20 min of examination and around 100,000 erythrocytes observed). The analytical specificity for malaria pathogens was tested within a panel of different microorganisms, and no cross-reactivity was observed between any of these species. In addition, the test was highly specific for all the individual Plasmodium spp.
To confirm the appropriate performance of the molecular diagnostic technique, an EC was included in each reaction. The emission of the EC signal makes it possible to confirm the validity of the extraction procedure and the absence of any nonspecific amplification and/or contamination.
Moreover, the freeze-dried reagents and the test can be shipped and stored at temperatures between 2 °C and 40 °C until the expiration date indicated on the label, a feature which is essential under restrictive conditions.
For early management and treatment, the reliable diagnosis of malaria remains a vital means of specifically detecting the presence of malarial parasites in cases of fever in endemic malarial regions. The time required for a complete molecular diagnosis according to the two techniques is less than three hours. Moreover, the Vitassay qPCR Malaria 5 test is performed with a lower risk of contamination in comparison with the homemade reference real-time PCR.
This kit was efficient in detecting malaria parasites with sensitivities ranging from 93.75% to 100% and specificities ranging from 97.7% to 100%. In malaria samples where parasitaemia was very low (<0.001%), the molecular diagnosis remained reliable.
There was no significant difference in the detection of mixed malaria infections. The major advantage of using this assay would be to detect mixed infections, as is the case in French Guiana and the Republic of Djibouti [9,10,11]. Microscopy can miss co-infections, especially when one species is more predominant in the isolate [12,13]. Detecting mixed infections has clinical importance. Infection with P. falciparum is known to lead to severe malaria. By contrast, P. ovale, P. vivax, or P. malariae cause less severe infections. Cases of P. vivax severe infections have been reported at low prevalence in the last decade. Adequate diagnosis for appropriate treatment (artemisinin-based combination therapy followed by primaquine) leads majorly to prevent relapse in cases of co-infection of P. falciparum with P. vivax or P. ovale [14,15]. Uncomplicated non-falciparum malaria can be treated by chloroquine but falciparum malaria cannot, due to resistance [16]. The risk of clinical treatment failure with mixed infection after initial treatment is higher compared with the treatment of P. falciparum [17]. In conclusion, misdiagnosis of mixed infections can be a cause of treatment failure. Moreover, patients with mixed infections had a higher proportion of multiple organ failure than those with P. falciparum mono-infection [18].
In the context of P. ovale parasites, there was no difference in diagnosis between the two species, P. ovale curtisi and P. ovale wallikeri. The majority of imported malaria cases in metropolitan France diagnosed by the Malaria CNR come from Africa, where P. falciparum is predominant, but also from specific African countries (Côte d’Ivoire, Gabon, and Senegal) where the transmission of P. ovale has been reported [19,20,21]. Between 2000 and 2015, 6468 cases of malaria were reported in the French armed forces, with 60.7% being P. falciparum, 29.0% P. vivax, 7.2% P. ovale, and 1.8% P. malariae [22]. Moreover, every year the French armed forces conduct military operations in endemic malaria areas including French Guiana, where P. vivax is predominant [9]. Consequently, the use of a specific PCR kit is important to detect all human Plasmodium species.
The limitations of this study include the low number of samples. Although 190 malaria samples were tested, given the African origin of these samples, none were identified as P. knowlewsi.
Diagnostic tools for malaria have expanded beyond blood smear microscopy, previously the gold-standard technique. Molecular and innovative techniques have emerged, including RDTs and methods derived from PCR such as nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP) [23]. These molecular diagnostic methods have higher sensitivity and specificity and allow the detection of low parasitaemia. The early and safe diagnosis of malaria is of paramount importance to ensure appropriate treatment and reduce the incidence of severe forms of the disease and deaths. The concomitant use of a molecular method and the gold standard for the identification of malaria parasites would ensure reliable diagnosis [24]. Microscopy always had limitations, i.e., low parasitaemia, slide quality, and staining problems. Moreover, microscopic techniques require trained personnel and are time-consuming. Molecular diagnostic techniques have higher sensitivity and allow identify mixed infections. However, in resource-poor settings in endemic countries, the use of these techniques is less feasible. With advancements and affordable technology with portable machines, these techniques could reach more people.

5. Conclusions

The Vitassay qPCR Malaria 5 test has been shown to be a reliable tool for the diagnosis of malaria in non-endemic countries, detecting low parasitaemia and mixed infections with a sensitivity similar to the homemade reference real-time PCR methods, but is more practical to use due to its multiplex nature.

Author Contributions

Conceptualization, M.M. and B.P.; methodology, M.M.; validation, M.M.; formal analysis, M.M.; investigation, R.A. and N.B.; resources, French National Reference Centre for Imported Malaria Study Group; data curation, B.P.; writing—original draft preparation, M.M.; writing—review and editing, B.P.; supervision, M.M. and B.P.; project administration, B.P.; funding acquisition, B.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the French Institute for Public Health Surveillance (Santé Publique France), grant CNR Paludisme.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Informed consent was not required for this study as it was performed under the statutory auspices of the French National Reference Centre for Imported Malaria, and isolates were anonymised by re-coding. In accordance with Article 6.1.e of the General Data Protection Regulation (GDPR) which came into force on 25 May 2018, the processing operations implemented by the CNRs within the framework of their missions are based on the execution of a mission of public interest (Art. L 1413-3, R. 1413.46 of the French Public Health Code). This removes the need to obtain patients’ prior consent. Additionally, bio-banking human clinical samples used for malaria diagnosis and secondary uses for scientific purposes are possible as long as the corresponding patients are informed, and they do not indicate any objections.

Data Availability Statement

The datasets analysed in this study are available from the corresponding author upon reasonable request.

Acknowledgments

The authors thank the Servibio Group (Courtaboeuf, France) who sent us the Vitassay qPCR Malaria 5 tests. We also thank Alexis Simao (Sales Manager, Servibio Group) for her technical assistance and for proofreading the manuscript. The members of the French National Reference Centre for Imported Malaria Study Group are as follows: V. Augis (Groupe Hospitalier Pellegrin, Bordeaux), A. Aribau (Groupement Hospitalier Portes de Provence, Montélimar), E. Aribau (Groupement Hospitalier Portes de Provence, Montélimar), P. Bastien (Centre Hospitalier Universitaire de Montpellier, Montpellier), A. Berry (Centre Hospitalier Universitaire de Rangueil, Toulouse), P. Brouqui (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), P. Chauvin (Centre Hospitalier Universitaire de Rangueil, Toulouse), M. Cividin (Centre Hospitalier du Pays d’Aix, Aix en Provence), N. Coron (LBM Bioestérel, Mouans-Sartoux), F. Courtier (Centre Hospitalier de Valence, Valence), C. Darles (Hôpital d’Instruction des Armées Saint-Anne, Toulon), C. Dasy (Centre Hospitalier du Pays d’Aix, Aix en Provence), P. Delaunay (Centre Hospitalier Universitaire de l’Archet, Nice), L. Delhaes (Groupe Hospitalier Pellegrin, Bordeaux), L. Decoeur (Centre Hospitalier de Dax, Dax), M. Drancourt (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), V. Dumas (Groupe Hospitalier Pellegrin, Bordeaux), T. Dutheil (Centre Hospitalier Ouest Réunion), A. Duthilly (Centre Hospitalier des Escartons, Briançon), B. Faucher (Hôpital d’Instruction des Armées Saint-Anne, Toulon), A. Genin (Centre Hospitalier du Pays d’Aix, Aix en Provence), E. Garnotel (Hôpital d’Instruction des Armées Laveran, Marseille), S. Hammani (Centre Hospitalier Intercommunal Alpes du Sud, Sisteron), F. Janvier (Hôpital d’Instruction des Armées Saint-Anne, Toulon), E. Javelle (Hôpital d’Instruction des Armées Laveran, Marseille), C. L’Ollivier (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), J.C. Lagier (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), E. Ledault (Hôpital d’Instruction des Armées Laveran, Marseille), M. Leveque (Centre Hospitalier Universitaire de Montpellier, Montpellier), A. Lignereux (Centre Hospitalier Ouest Réunion), D. Malvy (Groupe Hospitalier Pellegrin, Bordeaux), A. Marin (Hôpital Européen, Marseille), P. Marty (Centre Hospitalier Universitaire de l’Archet, Nice), L. Menier (Hôpital d’Instruction des Armées Saint-Anne, Toulon), E. Menu (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), P. Millet (Groupe Hospitalier Pellegrin, Bordeaux), P. Minodier (Hôpital Nord, Marseille), P. Munier (Centre Hospitalier de Valence, Valence), P. Parola (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), G. Pasquier (Centre Hospitalier Universitaire de Montpellier, Montpellier), C. Pianetti (Centre Hospitalier Ouest Réunion), Y. Pepino (Centre Hospitalier Ouest Réunion), S. Picot (Hôpital de la Croix-Rousse, Lyon), J. Plantamura (Hôpital d’Instruction des Armées Saint-Anne, Toulon), C. Pomares-Estran (Centre Hospitalier Universitaire de l’Archet, Nice), M Raffenot (Centre Hospitalier Métropole Savoie, Chambéry), S. Ranque (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), M.C. Receveur (Groupe Hospitalier Pellegrin, Bordeaux), O. Ridoux (Centre Hospitalier de Digne, Digne-les-Bains), E. Sappa (Centre Hospitalier du Pays d’Aix, Aix-en-Provence), H. Savini (Hôpital d’Instruction des Armées Laveran, Marseille), J. Sevestre (Institut Hospitalo-Universitaire Méditerranée Infection, Marseille), Y. Sterkers (Centre Hospitalier Universitaire de Montpellier, Montpellier), C. Surcouf (Hôpital d’Instruction des Armées Laveran, Marseille), D. Thiberville (Cerballiance, Manosque), V. Thomas (Centre Hospitalier de Valence), and V. Urbain (Centre Hospitalier Universitaire de Montpellier, Montpellier).

Conflicts of Interest

The authors declare no conflict of interest. Neither the funders nor the Servibio Group played any role in the design of the study, in the collection, analyses, or interpretation of the data, in writing the manuscript, or in deciding to publish the results.

References

  1. World Malaria Report 2021. Available online: https://www.who.int/teams/global-malaria-programme/reports/world-malaria-report-2021 (accessed on 8 August 2022).
  2. Kendjo, E.; Houzé, S.; Mouri, O.; Taieb, A.; Gay, F.; Jauréguiberry, S.; Tantaoui, I.; Ndour, P.A.; Buffet, P.; Thellier, M.; et al. Epidemiologic trends in malaria incidence among travelers returning to metropolitan France, 1996–2016. JAMA Netw. Open 2019, 2, e191691. [Google Scholar] [CrossRef] [PubMed]
  3. Kamaliddin, C.; Le Bouar, M.; Berry, A.; Fenneteau, O.; Gillet, P.; Godineau, N.; Candolfi, E.; Houzé, S. Assessment of diagnostic methods for imported malaria in mainland France. Med. Mal. Infect. 2020, 50, 141–160. [Google Scholar] [CrossRef] [PubMed]
  4. Bamou, R.; Nematchoua-Weyou, Z.; Lontsi-Demano, M.; Ningahi, L.G.; Tchoumbou, M.A.; Defo-Talom, B.A.; Mayi, M.P.A.; Tchuinkam, T. Performance assessment of a widely used diagnostic test CareStart™ compared to microscopy for the detection of Plasmodium in asymptomatic patients in the Western region of Cameroon. Heliyon 2021, 7, e06271. [Google Scholar] [CrossRef] [PubMed]
  5. Larréché, S.; Rapp, C.; Delacour, H.; Sanmartin, N.; Ficko, C.; Bigaillon, C.; Andriamanantena, D.; Pilo, J.E.; Mérens, A. Sensitivity of parasitological tests in imported Plasmodium vivax malaria in adults and impact of chemoprophylaxis and attack type. J. Travel Med. 2014, 21, 195–200. [Google Scholar] [CrossRef] [PubMed]
  6. Gendrot, M.; Fawaz, R.; Dormoi, J.; Madamet, M.; Pradines, B. Genetic diversity and deletion of Plasmodium falciparum histidine-rich protein 2 and 3: A threat to diagnosis of P. falciparum malaria. Clin. Microbiol. Infect. 2019, 25, 580–585. [Google Scholar] [CrossRef]
  7. Wurtz, N.; Mint Lekweiry, K.; Bogreau, H.; Pradines, B.; Rogier, C.; Boukhary, A.O.M.S.; Hafid, J.E.; Salem, M.S.O.A.; Trape, J.F.; Basco, L.K.; et al. Vivax malaria in Mauritania includes infection of a Duffy-negative individual. Malar. J. 2011, 10, 336. [Google Scholar] [CrossRef] [Green Version]
  8. Joste, V.; Bailly, J.; Hubert, V.; Pauc, C.; Gendrot, M.; Guillochon, E.; Madamet, M.; Thellier, M.; Kendjo, E.; Argy, N.; et al. Plasmodium ovale wallikeri and P. ovale curtisi infections and diagnostic approaches to imported malaria, France, 2013–2018. Emerg. Infect. Dis. 2021, 27, 372–384. [Google Scholar] [CrossRef]
  9. Ginouves, M.; Veron, V.; Musset, L.; Legrand, E.; Stefani, A.; Prevot, G.; Demar, M.; Djossou, F.; Brousse, P.; Nacher, M.; et al. Frequency and distribution of mixed Plasmodium falciparum-vivax infections in French Guiana between 2000 and 2008. Malar. J. 2015, 14, 446. [Google Scholar] [CrossRef]
  10. Pommier de Santi, V.; Girod, R.; Mura, M.; Dia, A.; Briolant, S.; Djoussou, F.; Dusfour, I.; Mendibil, A.; Simon, F.; Deparis, X.; et al. Epidemiological and entomological studies of a malaria outbreak among French armed forces deployed at illegal gold mining sites reveal new aspects of the disease’s transmission in French Guiana. Malar. J. 2016, 15, 35. [Google Scholar] [CrossRef] [Green Version]
  11. Khaireh, B.A.; Briolant, S.; Pascual, A.; Mokrane, M.; Machault, V.; Travaillé, C.; Khaireh, M.A.; Farah, I.H.; Ali, H.M.; Abdi, A.I.A.; et al. Plasmodium vivax and Plasmodium falciparum infections in the Republic of Djibouti: Evaluation of their prevalence and potential determinants. Malar. J. 2012, 11, 395. [Google Scholar] [CrossRef]
  12. Nema, S.; Singh, A.; Krishna, S.; Poriya, R.; Dubey, S.; Ali, N.A.; Singh, M.P.; Verma, A.K.; Das, A.; Bharti, P.K. Unreported mixed Plasmodium species infection may increase vivax malaria in India: A challenge for malaria elimination. Trans. R. Soc. Trop. Med. Hyg. 2022, 116, 600–603. [Google Scholar] [CrossRef] [PubMed]
  13. Manor, U.; Grossman, T.; Vainer, J.; Schwartz, E. A nationwide study of imported Plasmodium ovale and mixed infections to Israel 2008–2020. J. Travel Med. 2022, 29, taab192. [Google Scholar] [CrossRef] [PubMed]
  14. Epelboin, L.; Rapp, C.; Faucher, J.F.; Méchaï, F.; Bottieu, E.; Matheron, S.; Malvy, D.; Caumes, E. Management and treatment of uncomplicated imported malaria in adults. Update of the French malaria clinical guidelines. Med. Mal. Infect. 2020, 50, 194–212. [Google Scholar] [CrossRef] [PubMed]
  15. Bouchaud, O.; Bruneel, F.; Caumes, E.; Houzé, S.; Imbert, P.; Pradines, B.; Rapp, C.; Strady, C. Management and prevention of imported malaria. 2018 update of the 2007 French clinical guidelines. Med. Mal. Infect. 2020, 50, 161–193. [Google Scholar] [CrossRef] [PubMed]
  16. Pradines, B. Antimalarial drug resistance: Clinical prospectives. In Antimicrobial Drug Resistance; Ouellette, M., Ed.; Springer: Berlin/Heidelberg, Germany, 2017; pp. 1245–1275. [Google Scholar]
  17. Mahittikorn, A.; Masangkay, F.R.; Kotepui, K.U.; Milanez, G.J.; Kotepui, M. The high risk of malaria recurrence in patients with Plasmodium-mixed infection after treatment with antimalarial drugs: A systematic review and meta-analysis. Parasit. Vectors 2021, 14, 280. [Google Scholar] [CrossRef]
  18. Kotepui, M.; Kotepui, K.U.; Milanez, G.J.; Masangkay, F.R. Plasmodium spp. mixed infection leading to severe malaria: A systematic review and meta-analysis. Sci. Rep. 2020, 10, 11068. [Google Scholar] [CrossRef]
  19. de Laval, F.; Simon, F.; Bogreau, H.; Rapp, C.; Wurtz, N.; Oliver, M.; Demaison, X.; Dia, A.; de Pina, J.J.; Merens, A.; et al. Emergence of Plasmodium ovale malaria among the French Armed Forces in the Republic of Ivory Coast: 20 years of clinical and biological experience. Clin. Infect. Dis. 2014, 58, e122–e128. [Google Scholar] [CrossRef] [Green Version]
  20. Manego, R.Z.; Mombo-Ngoma, G.; Witte, M.; Held, J.; Gmeiner, M.; Gebru, T.; Tazemda, B.; Mischlinger, J.; Groger, M.; Adegnika, A.A.; et al. Demography, maternal health and the epidemiology of malaria and other major infectious diseases in the rural department Tsamba-Magotsi, Ngounie Province, in central African Gabon. BMC Public Health 2017, 17, 130. [Google Scholar] [CrossRef] [Green Version]
  21. Roucher, C.; Rogier, C.; Sokhna, C.; Tall, A.; Trape, J.F. A 20-year longitudinal study of Plasmodium ovale and Plasmodium malariae prevalence and morbidity in a West African population. PLoS ONE 2014, 9, e87169. [Google Scholar] [CrossRef] [Green Version]
  22. Velut, G.; Dia, A.; Briolant, S.; Javelle, E.; Pommier de Santi, V.; Berger, F.; Savini, H.; Simon, F.; Michel, R.; Pradines, B. Le paludisme: Toujours d’actualité dans les armées françaises. Med. Armées 2018, 46, 13–26. [Google Scholar]
  23. Charpentier, E.; Benichou, E.; Pagès, A.; Chauvin, P.; Fillaux, J.; Valentin, A.; Guegan, H.; Guemas, E.; Salabert, A.S.; Armengol, C.; et al. Performance evaluation of different strategies based on microscopy techniques, rapid diagnostic test and molecular loop-mediated isothermal amplification assay for the diagnosis of imported malaria. Clin. Microbiol. Infect. 2020, 26, 115–121. [Google Scholar] [CrossRef] [PubMed]
  24. Berry, A.; Benoit-Vical, F.; Fabre, R.; Cassaing, S.; Magnaval, J.F. PCR-based methods to the diagnosis of imported malaria. Parasite 2008, 15, 484–488. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Comparative of the Ct values of the Vitassay CFX96TM versus the reference Light Cycler.
Figure 1. Comparative of the Ct values of the Vitassay CFX96TM versus the reference Light Cycler.
Diagnostics 12 02747 g001
Table 1. Identification of Plasmodium species of the 190 samples by homemade real-time PCR.
Table 1. Identification of Plasmodium species of the 190 samples by homemade real-time PCR.
P. falciparumP. vivaxP. ovaleP. malariaeP. falciparum
P. ovale
P. falciparum
P. malariae
P. falciparum
P. ovale
P. malariae
NegativeTotal
Selected samples62399320290
Other samples852720211100
Total147516113413190
Table 2. Sequences of primers and probes for reference RT-PCR.
Table 2. Sequences of primers and probes for reference RT-PCR.
Plasmodium SpeciesAccess Number GenesProbe or Primer NamePrimer Sequence
P. falciparumAquaglyceroporine
(AJ413249)
Probe PfFAM-5′ TACACTACCAACACATGGGGCTCAAGAGGT 3′- BHQ1
P falciparum F5′ TTTATGTATTGGTATAACATTCGG 3′
P falciparum R5′ GGCAAATAACTTTATCATAGAATTGAC 3′
P. vivaxEnoyl-acyl carrier protein reductase (AY423071)Probe PvHEX-5′ CATCTACGTGGACAACGGGCTCAACA 3′-BHQ1
P vivax F5′ GTGGCCGCCTTTTTGCT 3′
P vivax R5′CCTCCCTGAAACAAGTCATCG 3′
P. ovaleCircumsporozoïte
(S69014)
Probe PoHEX- 5′ ATTTTTTGCATCAACCTTTCTTCTAGCCC 3′-BHQ1
P ovale F5′ GGAGGAATGGTCACCATGTAGTGT 3′
P ovale R5′ CAAATTTCAGTTTCAAGGTCACTTAA 3′
P. malariaeOokinete surface protein 25 (AB074976)Probe PmFAM-5′ TTATTGTCCTCTGGGTTTGGAACTTTGCC 3′- BHQ1
P malariae F5′ CCAAGCCCAGATAATAAGGAAGGT 3′
P malariae R5′ TTCGTGCACTTCAACTTACATTCAGT 3′
Table 3. Comparison of the Vitassay qPCR Malaria 5 and the homemade real-time PCR results.
Table 3. Comparison of the Vitassay qPCR Malaria 5 and the homemade real-time PCR results.
VitassayHomemade Real-Time PCR
P. falciparumP. vivaxP. ovaleP. malariaeNegativeTotal
Positive153 + 1 a520 + 1 c150195
Negative1 b001 c35
Total155521163200
a Isolate identified as P. ovale using homemade real-time PCR and detected as P. falciparum and P. ovale using the Vitassay qPCR Malaria 5 test. b Isolate identified P. falciparum using homemade real-time PCR and negative using the Vitassay qPCR Malaria 5 test. c Isolate identified as P. falciparum and P. malariae using homemade real-time PCR and detected as P. falciparum and P. ovale using the Vitassay qPCR Malaria 5 test.
Table 4. Sensitivity and specificity of the Vitassay qPCR Malaria 5 for each Plasmodium species.
Table 4. Sensitivity and specificity of the Vitassay qPCR Malaria 5 for each Plasmodium species.
Plasmodium SpeciesSensitivity a
Vitassay qPCR Malaria 5
Specificity b
Vitassay qPCR Malaria 5
P. falciparum99.35%97.72%
P. vivax100%100%
P. ovale100%99.44%
P. malariae93.75%100%
a Sensitivity: TP/(TP + FN). b Specificity: TN/(FP + TN).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Madamet, M.; Amalvict, R.; Benoit, N.; French National Reference Centre for Imported Malaria Study Group; Pradines, B. Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics 2022, 12, 2747. https://doi.org/10.3390/diagnostics12112747

AMA Style

Madamet M, Amalvict R, Benoit N, French National Reference Centre for Imported Malaria Study Group, Pradines B. Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics. 2022; 12(11):2747. https://doi.org/10.3390/diagnostics12112747

Chicago/Turabian Style

Madamet, Marylin, Rémy Amalvict, Nicolas Benoit, French National Reference Centre for Imported Malaria Study Group, and Bruno Pradines. 2022. "Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France" Diagnostics 12, no. 11: 2747. https://doi.org/10.3390/diagnostics12112747

APA Style

Madamet, M., Amalvict, R., Benoit, N., French National Reference Centre for Imported Malaria Study Group, & Pradines, B. (2022). Assessment of a Commercial Real-Time PCR Assay (Vitassay qPCR Malaria 5 Test) to Detect Human Malaria Infection in Travelers Returning to France. Diagnostics, 12(11), 2747. https://doi.org/10.3390/diagnostics12112747

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop
  NODES
admin 3
Association 2
Idea 1
idea 1
innovation 2
INTERN 30
Note 10
Project 2
twitter 1